Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

Abstract

BackgroundInhibins are important regulators of the female reproductive system. Recently, two new inhibin subunits betaC and betaE have been described, although it is unclear if they are synthesized in normal human endometrium.MethodsSamples of human endometrium were obtained from 82 premenopausal, non-pregnant patients undergoing gynecological surgery for benign diseases. Endometrium samples were classified according to anamnestic and histological dating into proliferative (day 1-14, n = 46), early secretory (day 15-22, n = 18) and late secretory phase (day 23-28, n = 18). Immunohistochemical analyses were performed with specific antibodies against inhibin alpha (n = 81) as well as inhibin betaA (n = 82), betaB (n = 82), betaC (n = 74) and betaE (n = 76) subunits. RT-PCR was performed for all inhibin subunits. Correlation was assessed with the Spearman factor to assess the relationship of inhibin-subunits expression within the different endometrial samples.ResultsThe novel inhibin betaC and betaE subunits were found in normal human endometrium by immunohistochemical and molecular techniques. Inhibin alpha, betaA, betaB and betaE subunits showed a circadian expression pattern, being more abundant during the late secretory phase than during the proliferative phase. Additionally, a significant correlation between inhibin alpha and all inhibin beta subunits was observed.ConclusionsThe differential expression pattern of the betaC- and betaE-subunits in normal human endometrial tissue suggests that they function in endometrial maturation and blastocyst implantation. However, the precise role of these novel inhibin/activin subunits in human endometrium is unclear and warrants further investigation.

Identification of noninvasive diagnostic biomarkers for ectopic pregnancy using data-independent acquisition (DIA)proteomics: a pilot study

“…Inhibin beta C (INHBC) belongs to the transforming growth factor beta (TGF-β) family, widely exists in the placenta and endometrium, and has an anti-cell proliferation effect 28 – 30 . Abdoli et al and Fortes et al pointed out that the INHBC gene is involved in the inheritance of reproductive traits of sheep and cattle 31 , 32 , and some scholars also pointed out that INHBC is involved in the blastocyst implantation process 33 . C-type lectin domain family 3 member B (CLEC3B) is a binding protein that has a specific binding effect on plasminogen kringle-4 34 .…”

Correction: Evidence of inhibin/activin subunit betaC and betaE synthesis in normal human endometrial tissue

“…We have previously demonstrated the expression of inhibin subunits in endometrial tissues and used β-actin primer pairs to perform a PCR analysis loading control [ 1 ]. However, instead of using the mentioned β-actin primer pairs from a commercial molecular biology supplier, we used the β-actin primer pair listed in Table 1 .…”

Inhibin-α subunit in normal and malignant human cervical tissue and cervical cancer cell lines

“…Negative controls were performed by replacing the primary antibody with normal rabbit IgG as isotype control in the same dilution compared to the primary antibody, respectively. Immunohistochemical staining was performed using an appropriate positive control comprising ovaries containing follicular cysts (16,26,27). Positive cells showed a brownish color and negative controls as well as unstained cells were blue.…”

“…Reverse transcription was performed with M-MLV reverse transcriptase and oligo(dT) (Promega, Mannheim, Germany) as recommended by the supplier. PCR was performed in an Eppendorf Mastercycler with GoTaq (Promega) as previously described (25,27). Primer sequences to amplify a 359-bp fragment of inhibin-α were in 5'-3' orientation: CCGGCCATCCCAGCATACACGC (forward primer) and GAGTTGAGCGTCGGGCTCTC (backward primer).…”

“…Immunohistochemistry was performed using a combination of pressure cooker heating and the standard streptavidin-biotin-peroxidase complex by using the mouse-IgG Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA, USA) as previously described (16,(25)(26)(27) with slightly modi fications.…”