Evidence for translocation of oral Parvimonas micra from the subgingival sulcus of the human oral cavity to the colorectal adenocarcinoma

Abstract

Background: The carcinogenesis of colorectal cancer (CRC) is a multifactorial process involving both environmental and host factors, such as human genetics or the gut microbiome, which in CRC patients appears to be enriched in oral microorganisms. The aim of this work was to investigate the presence and activity of Parvimonas micrain CRC patients. To do that, samples collected from subgingival sulcus and neoplastic lesions were used for culturomics. Then, samples from different body locations (saliva, gingival crevicular fluid, feces, non-neoplastic colon mucosa, transition colon mucosa, adenocarcinoma, adenomas, metastatic and non-neoplastic liver samples) were used for 16S rRNA metabarcoding and metatranscriptomics. Whole genome sequencing was conducted for all P. micrastrains obtained. Results: Several P. micraisolates from the oral cavity and adenocarcinoma tissue from CRC patients were obtained. The comparison of oral and tumoral P. micra genomes identified that a pair of clones (PM89KC) were 99.2% identical between locations in one CRC patient, suggesting that the same clone migrated from oral cavity to the gut. The 16S rRNA metabarcoding analysis of samples from this patient revealed that P. micra cohabits with other periodontal pathogens such as Fusobacterium, Prevotella or Dialister, both in the intestine, liver and the subgingival space, which suggests that bacterial translocation from the subgingival environment to the colon or liver could be more efficient if these microorganisms travel together forming a synergistic consortium. In this way, bacteria might be able to perform tasks that are impossible for single cells. In fact, RNA-seq of the adenocarcinoma tissue confirmed the activity of these bacteria in the neoplastic tissue samples and revealed that different oral species, including P. micra, were significantly more active in the tumor compared to non-neoplastic tissue from the same individuals. Conclusion: P. micra appears to be able to translocate from the subgingival sulcus to the gut, where oral bacteria adapt to the new niche and could have a relevant role in carcinogenesis. According to our findings, periodontal disease, which increases the levels of these pathogens and facilitates their dissemination, could represent a risk factor for CRC development and P. micra could be used as a non-invasive CRC biomarker.

The multispecies microbial cluster of Fusobacterium, Parvimonas, Bacteroides and Faecalibacterium as a precision biomarker for colorectal cancer diagnosis

“…Most of the oral microorganisms detected in our samples were strict anaerobes (e.g., Fusobacterium, Parvimonas, Prevotella, Peptostreptococcus, and Porphyromonas), which are probably translocated from the subgingival cavity to the gut, as reported previously [34,55,74,75]. As a matter of fact, our team demonstrated recently the translocation of P. micra from the gingival cavity to the gut in a patient diagnosed with CRC and advanced periodontal disease (PD) [55]. These oral bacteria, especially Fusobacterium and Parvimonas, were also over-represented in samples from other CRC studied cohorts [23,37,49,50,76].…”

“…Bacterial DNA extraction from the samples was performed using the MasterPureTM Complete DNA and RNA Purification Kit (Epicentre, Madison, WI, USA). Our team has previously provided a comprehensive and detailed exposition of this methodology [ 55 ].…”

“…Negative controls for each extraction were done to avoid contaminations. All these protocols were described in greater detail in a previous work [ 55 ].…”

“…Two hypervariable regions of the 16S rRNA gene (V3‐V4) were amplified by PCR using the following oligonucleotides: 5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG as the forward primer and 5′ GTCTCGTGGGCTCGGAGATGT GTATAAGAGACAGGACTACHVGGGTATCTAATCC as the reverse primer [ 55 , 56 ].…”

“…Library sizes were assessed with a 2100 Bioanalyzer (Agilent Technologies, St. Clara, CA, USA). This sequencing protocol was in‐depth detailed in a previous publication [ 55 ].…”