Evidence for Small RNAs Homologous to Effector-Encoding Genes and Transposable Elements in the Oomycete Phytophthora infestans

Abstract

Phytophthora infestans is the oomycete pathogen responsible for the devastating late blight disease on potato and tomato. There is presently an intense research focus on the role(s) of effectors in promoting late blight disease development. However, little is known about how they are regulated, or how diversity in their expression may be generated among different isolates. Here we present data from investigation of RNA silencing processes, characterized by non-coding small RNA molecules (sRNA) of 19–40 nt. From deep sequencing of sRNAs we have identified sRNAs matching numerous RxLR and Crinkler (CRN) effector protein genes in two isolates differing in pathogenicity. Effector gene-derived sRNAs were present in both isolates, but exhibited marked differences in abundance, especially for CRN effectors. Small RNAs in P. infestans grouped into three clear size classes of 21, 25/26 and 32 nt. Small RNAs from all size classes mapped to RxLR effector genes, but notably 21 nt sRNAs were the predominant size class mapping to CRN effector genes. Some effector genes, such as PiAvr3a, to which sRNAs were found, also exhibited differences in transcript accumulation between the two isolates. The P. infestans genome is rich in transposable elements, and the majority of sRNAs of all size classes mapped to these sequences, predominantly to long terminal repeat (LTR) retrotransposons. RNA silencing of Dicer and Argonaute genes provided evidence that generation of 21 nt sRNAs is Dicer-dependent, while accumulation of longer sRNAs was impacted by silencing of Argonaute genes. Additionally, we identified six microRNA (miRNA) candidates from our sequencing data, their precursor sequences from the genome sequence, and target mRNAs. These miRNA candidates have features characteristic of both plant and metazoan miRNAs.

Phytophthora infestans effector Pi14054 is a novel candidate suppressor of host silencing mechanisms

“…It is characterized by non-coding small RNA molecules (sRNA) of 19-40 nt (Holoch and Moazed 2015;Åsman et al 2016;Vetukuri et al 2012;Vetukuri et al 2013). RNA silencing operates both at the transcriptional and post-transcriptional levels.…”

“…The transcript profiles are shown in pre-infection stages (zoospores and germinating cysts) and at 12, 24, 36, 48, and 60 h post-inoculation (hpi) of potato cultivar Bintje relative to the mRNA level of Actin A and Ubiquitin in the zoospore pre-infection stage. All calculations and statistical analyses were carried out as described in Vetukuri et al (2012). Error bars represent confidence intervals calculated from three biological replicates transcripts accumulated during P. infestans infection of potato leaves, quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was carried out.…”

“…Infection assays, preparation of isolate 88069 life cycle stages, and sample collection were carried out as described (Vetukuri et al 2011a). Total RNA preparations, DNase treatment, cDNA synthesis, qRT-PCR assay, and calculations were performed as described previously (Vetukuri et al 2012). qRT-PCR assays were performed with Actin A (PITG_15117) (Vetukuri et al 2012) and Ubiquitin (PITG_07230) (Jahan et al 2015) as endogenous controls.…”

“…Total RNA preparations, DNase treatment, cDNA synthesis, qRT-PCR assay, and calculations were performed as described previously (Vetukuri et al 2012). qRT-PCR assays were performed with Actin A (PITG_15117) (Vetukuri et al 2012) and Ubiquitin (PITG_07230) (Jahan et al 2015) as endogenous controls. Primers were designed and optimized to amplify Pi14054 (Fw 5′ GCGAAATGGGGAACTACGAC 3′ and Rv 5′ TGAGCCTTTAGAGCTTCCCC 3′) and transcript levels were analyzed as described previously (Vetukuri et al 2012).…”

“…qRT-PCR assays were performed with Actin A (PITG_15117) (Vetukuri et al 2012) and Ubiquitin (PITG_07230) (Jahan et al 2015) as endogenous controls. Primers were designed and optimized to amplify Pi14054 (Fw 5′ GCGAAATGGGGAACTACGAC 3′ and Rv 5′ TGAGCCTTTAGAGCTTCCCC 3′) and transcript levels were analyzed as described previously (Vetukuri et al 2012). Transcript abundance in germinating cysts and infection time points on Bintje (12, 24, 36, 48 and 60 h post inoculation (hpi)) was compared with the level of transcript in the calibrator stage (zoospores of isolate 88069).…”