Evaluation on aStreptococcus suisVaccine Using Recombinant Sao-L Protein Manufactured by Bioreactors as the Antigen in Pigs

Abstract

Streptococcus suis (S. suis) can be classified into 33 serotypes based on the structure of capsular polysaccharides. Recent research indicated that a new surface protein designated as Sao (surface antigen one) reacts with 30 serotypes of convalescent-phase sera during S. suis infections, which makes Sao a good potential antigen for developing S. suis vaccines. The objectives of this study were to produce recombinant Sao-L protein (rSao-L) from a strain of S. suis serotype 2 by a prokaryotic expression system in bioreactors and to use rSao-L as the antigen for a S. suis vaccine in mouse and swine models. The antibody titres in mice and pigs immunized with rSao-L were significantly (P < 0.05) increased. After challenge with live S. suis serotype 1 bacteria, the anatomical lesions in pigs immunized with rSao-L were reduced by 60%. These data indicated that immunization with rSao-L can confer cross-serotype protection against S. suis. Moreover, percentages of CD8(+) and CD4(+) /CD8(+) double-positive T cells in immunized pigs were significantly higher than those of the control group (P < 0.01). Using bioreactors to produce rSao-L as the antigen for S. suis vaccines may broaden protective efficacy and reduce production costs.

Immunization with Streptococcus suis bacterin plus recombinant Sao protein in sows conveys passive immunity to their piglets

“…Bacteria were grown in brain-heart infusion (BHI) broth supplemented with 0.5% yeast extract (Difco Laboratories, Spark, MD, USA) at 37 °C. The rSao was expressed as previously described [19]. The size of PCR product from the S. suis strain BCRC 14750 (ATCC 43765) was 2013 bp.…”

“…We previously demonstrated that immunization with recombinant Sao-L protein (rSao-L) from a strain of S. suis serotype 2 in pigs was able to increase antigen-specific antibody titers, the percentages of CD8 + and CD4 + /CD8 + double-positive T cells, and cross-protection against S. suis serotype 1 heterologous challenge [19]. Since weaning piglets are more susceptible to S. suis infections due to the stress associated with weaning, prepartum immunization in sows may convey passive immunity to piglets and provide protection.…”

Diagnostik Antijen Olarak Rekombinant Sao-M Protein Kullanılarak Streptococcus suis’in Tanısı Amacıyla PPA-ELİSA Geliştirilmesi

“…In 2012, Hsueh et al [25] established ELISA using Sao-L and Sao-M for detecting titers of Sao-L-specific total IgG and Sao-M-specific total IgG. In the present study, Sao-M was used to establish PPA-ELISA for the diagnosis of S. suis infection.…”

“…JF 810176. The primer of the Sao-M gene was: Sao-F: GCGGGATCC ATGAATACTAAGAAATGGAG and Sao-R: CAGAAGCTTGAACTA ATTTACGTTTACGTG [25] . The forward and reverse primers contained BamH I and Hind III recognition sequences, respectively.…”

“…Sao is highly conserved protein among most S. suis strains and has become an important candidate for the subunit S. suis vaccines [22] . Immunization with recombinant Sao protein was capable of provoking strong humoral antibody responses, diminish clinical signs and bacterial dissemination, improve survival rates and provide cross-serotype protection in pig and mouse vaccination protocols [24] , indicating rSao is a suitable antigen for subunit S. suis vaccine development [25] . Sao protein is encoded by three allelic variants of gene of difference lengths, Sao-S (1.5 kb), Sao-M (1.7 kb) and Sao-L (2.0 kb), and Sao-M is the most prevalent variant comprising about 80% [26] .…”