Evaluation of the role of heterogeneous nuclear ribonucleoprotein A1 as a host factor in murine coronavirus discontinuous transcription and genome replication

Abstract

Viruses with RNA genomes often capture and redirect host cell components to assist in mechanisms particular to RNA-dependent RNA synthesis. The nidoviruses are an order of positive-stranded RNA viruses, comprising coronaviruses and arteriviruses, that employ a unique strategy of discontinuous transcription, producing a series of subgenomic mRNAs linking a 5 leader to distal portions of the genome. For the prototype coronavirus mouse hepatitis virus (MHV), heterogeneous nuclear ribonucleoprotein (hnRNP) A1 has been shown to be able to bind in vitro to the negative strand of the intergenic sequence, a cis-acting element found in the leader RNA and preceding each downstream ORF in the genome. hnRNP A1 thus has been proposed as a host factor in MHV transcription. To test this hypothesis genetically, we initially constructed MHV mutants with a very high-affinity hnRNP A1 binding site inserted in place of, or adjacent to, an intergenic sequence in the MHV genome. This inserted hnRNP A1 binding site was not able to functionally replace, or enhance transcription from, the intergenic sequence. This finding led us to test more directly the role of hnRNP A1 by analysis of MHV replication and RNA synthesis in a murine cell line that does not express this protein. The cellular absence of hnRNP A1 had no detectable effect on the production of infectious virus, the synthesis of genomic RNA, or the quantity or quality of subgenomic mRNAs. These results strongly suggest that hnRNP A1 is not a required host factor for MHV discontinuous transcription or genome replication.

Nuclear functions of heterogeneous nuclear ribonucleoproteins A/B

“…The roles of hnRNPA/B proteins in DNA metabolism also include the maintenance of telomeres, the protein-DNA complexes that cap the chromosome ends in some cells, preventing them from being illegitimately fused by the repair machinery for DNA double-stranded breaks [96]. The telomeres for vertebrates are comprised of a TTAGGG repeat [97,98], with a G-rich, single-stranded 3' overhang AUUUA A1 [74] d(GGCAG)n A1 [197] UAGACUAGA A1 [149] UAGAGUAGG A1 [149] UAGAUUAGA A1 [149] UAG binding site A1 [198] nYAGGn A1 [199] UACCUUUAGAGUAGG A1 [157] AUAGAAGAAGAA A1 [144] UUAGAUUAGA A1 [200] UAGGGCAGGC A1 [147] UAUGAUAGGGACUUAGGGUG A1 [201] UUAG A1 [78] A2RE, A2RE-1, A2RE-2, A2RE11 A2, A3 [55] pri-miR-18a A1 [202] [ 99 -101], which invades the double-stranded region of the telomeric DNA, forming a T-loop structure ( Fig. 2) [102].…”

Tristetraprolin Regulates the Expression of the Human Inducible Nitric-Oxide Synthase Gene

“…Some RNA-binding proteins, such as AUF1 or heteronuclear ribonucleoprotein A1, have been described to also display DNA-binding activity and to regulate the promoter activity of different genes (Fuentes-Panana et al, 2000;Shen and Masters, 2001). To exclude the possibility that the tristetraprolin-mediated effects on human iNOS expression also resulted from regulation of human iNOS promoter activity by tristetraprolin, we transiently transfected the plasmid pNOS2(16)Luc into the three different cell pools (pZeo, pZeohTTPs, and pZeo-hTTPas) and determined luciferase activity after cytokine-induction.…”

Proteomics Analysis of the Tombusvirus Replicase: Hsp70 Molecular Chaperone Is Associated with the Replicase and Enhances Viral RNA Replication

“…In addition, the cellular COPII proteins are involved in the assembly of the poliovirus replication complex (39). hnRNP A1 was found to be part of the mouse hepatitis virus transcription/replication complex, and it is involved in subgenomic RNA synthesis and genome replication (42,50). Overall, the above examples illustrate that host factors play complex and significant roles in the replication of many plus-stranded RNA viruses.…”