Evaluation of Streptomyces sp. obtained from herbal vermicompost for broad spectrum of plant growth-promoting activities in chickpea

Abstract

Five strains of Streptomyces sp. ; demonstrated previously to have potential for control of Fusarium wilt disease in chickpea and plant growth promotion [PGP] in rice) were evaluated for their PGP capabilities in chickpea in the 2012-2013 and 2013-2014 post-rainy seasons. The plots inoculated with Streptomyces sp. significantly enhanced number of nodule, nodule weight, root weight, and shoot weight at 30 days after sowing (DAS) and number of pod, pod weight, leaf area, leaf weight, and stem weight at 60 DAS in both seasons over the un-inoculated control plots. At chickpea crop maturity, all of the Streptomyces strains significantly enhanced stover yield, grain yield, and total dry matter in both seasons over the un-inoculated control. In the rhizosphere, the Streptomyces strains also significantly enhanced soil biological and mineral nutrient activities including microbial biomass carbon, dehydrogenase activity, total nitrogen, available phosphorous, and organic carbon in both seasons over the uninoculated control. All of the five strains were found superior in terms of nodule formation, root and shoot development, and crop productivity; however, KAI-xx had little edge over the other five strains. Scanning electron microscopy (SEM) analysis had revealed the success of colonization by the strains of Streptomyces sp. of the chickpea roots. Quantitative real-time PCR (qRT-PCR) analysis of selected PGP genes revealed overall upregulation of β-1,3-glucanase, indole-3-acetic acid, and siderophore genes in the Streptomyces species studied. This investigation further confirms the broad spectrum of PGP activities by the selected Streptomyces sp.

Plant growth-promotion by Streptomyces spp. in sorghum (Sorghum bicolor L.)

“…The reason for selecting only β-1,3-glucanase, IAA and siderophore traits for expression profiles is that these three traits are directly linked to growth promotion of the plants. Similar results were also reported by Gopalakrishnan et al (2013bGopalakrishnan et al ( , 2015a which support the PGP by Streptomyces strains.…”

“…was studied by scanning electron microscopy (SEM) as per the protocols of Gopalakrishnan et al (2015a). In brief, the seeds of sorghum (SPV1411) were surface-sterilized with 2.5% chlorox for 5 min followed by 70% ethanol in water for 5 min and rinsed with sterilized water (several times).…”

“…IAA, siderophore and β-1,3-glucanase gene-specific primers for qRT-PCR were designed using primer 3 software (Rosen and Skaletsky, 2000). Genes relating to IAA (F: GTCACCGGGATCTTCTTCAAC; R: GATGTCGGTGTTCTTGTCCAG), siderophore (F: ATCCTCAACACCCTGGTCTG; R: TCCTTGTACTGGTACGGGACTT) and β-1,3-glucanase (F: CCGAACACCACCTACTCCAC; R: CCAGGTTGAGGATCAGGAAG) production were collected from UniprotKB database (http://www.uniprot.org/uniprot) as described in Gopalakrishnan et al (2015a). PCR reactions and data analysis were done as described by Gopalakrishnan et al (2015a).…”

Plant growth-promoting actinobacteria: a new strategy for enhancing sustainable production and protection of grain legumes

“…This is supported by the existence of nif sequence homology in both Rhizobium and Frankia, the absence of nod genes in the latter (Ceremonie et al 1999). Even under field conditions, enhanced nodulation of chickpea and soil N content observed upon the application of Streptomyces inoculants indicates their promotional effect and influence of rhizobia-legume symbiosis in a non-specific manner (Gopalakrishnan et al 2015a, b). However, a detailed understanding of the mechanisms on this symbiotic mode needs to be established.…”

Evaluation of Streptomyces spp. and Bacillus spp. for biocontrol of Fusarium wilt in chickpea (Cicer arietinum L.)

“…The roots of chickpea were tested for colonisation by Streptomyces and Bacillus spp. by SEM analysis (Gopalakrishnan et al 2015). The samples were examined with a scanning electron microscope (JOEL-JSM 5600) as per the standardised procedure at RUSKA lab, College of Veterinary Science, Rajendranagar, Hyderabad, India.…”