Evaluation of Reference Genes for the Relative Quantification of Apple stem grooving virus and Apple mosaic virus in Apple Trees

Abstract

A SYBR Green Ò -based one step RT-qPCR assay was developed for the detection and quantification of Apple stem grooving virus (ASGV) and Apple mosaic virus (ApMV). The RT-qPCR assay employed seven plantexpressed genes-glyceraldehyde 3-phosphate dehydrogenase (GAPDH), 18S ribosomal RNA, ubiquitin, ribosomal protein S19, Rubisco, RNA polymerase subunit II and bactin-as internal reference housekeeping genes in a relative quantification system in three apple cultivars (i.e. Idared, Champion, Fragrance). The average expression stability (M) found by GeNorm software suggest that GAPDH and S19 were the most stable reference genes. We propose employing GAPDH and S19 as housekeeping genes for accurate quantification of ASGV and ApMV in apple leaf samples. The detection limit for both viruses was found around 70 copies of viral genome by one-step RT-qPCR.The fluorescence-based quantitative real-time PCR (qPCR) has been used to detect and measure nucleic acids of a wide range of plant viruses with RNA and DNA genome [13,16,17]. Two main qPCR based techniques: relative and absolute quantification have emerged from various studies on virus detection and quantification of virus titer. The ''absolute quantification'' with known standard is the most commonly used for plant virus quantification. On the other hand, relative quantification uses a comparative quantification with internal reference endogenous housekeeping control genes [1]. The relative quantification determines the changes in RNA levels of a gene across multiple samples and expresses it relative to the levels of an internal control RNA. Therefore, relative quantification does not require standards with known concentrations [15]. Relative quantification employing reference internal control genes was used for several plant virus detection and quantification studies [5,6]. A comparative study showed that the relative quantification assay may be as accurate as absolute quantification when appropriate housekeeping genes are used and normalized with target genes [6,10]. In this paper we have chosen endogenous housekeeping genes for quantification of viruses in apple trees in a relative quantification system. Two apple tree infecting viruses, Apple stem grooving virus (ASGV) and Apple mosaic virus (ApMV) are selected. ASGV and ApMV belong to the most frequently emerged pathogens encounters in pome fruit trees. Several molecular-based methods have been elaborated to perform routine detection [7,8,11,12]. However, a highly sensitive real-time based detection and quantification assay for these viruses is missing so far. We described here a SYBER green based relative quantification assay employing appropriate endogenous reference genes as internal control.A total of 39 samples coming from different apple cultivars grown in vitro culture (i.e. Idared, Champion, Fragrance) healthy (14 plants) and infected (25 plants) have been used to validate the reference genes as well as the target genes. The leaves of plant material were grinded in liquid nitrogen and the total RNA ...

Gene expression profiling by cDNA-AFLP reveals potential candidate genes for partial resistance of ‘Président Roulin’ against Venturia inaequalis

“…The relative expression ratio of the target genes between scab-inoculated and water-treated plants was evaluated using the ΔΔCt method described by Applied Biosystems (Relative expression ratio = 2 ΔΔCt ), with the glyceraldehyde 3-phosphate dehydrogenase gene ( GAPDH ) as the internal reference (primers sequence F-5′CAAGGTCATCCATGACAACTTTG3′, R-5′ GTCCACCACCCTGTTGCTGTAG3′). In fact, as it was the case in other qRT-PCR studies conducted on apple [ 33 , 103 ], the GAPDH gene appeared to be the best housekeeping gene in our experimental conditions. Contrary to the elongation factor gene ( EF, primers sequence F-5′TACTGGAACATCACAGGCTGAC3′, R-5′TGGACCTCTCAATCATGTTGTC3′), expression of the GAPDH was stable in scab-inoculated and water-treated leaf samples (Additional file 4 ).…”

Identification of appropriate reference genes for RT-qPCR analysis in Juglans regia L.

“…Consequently, it is very important to assess gene expression levels with a stable reference gene. Numerous genes related to basic metabolism or cellular processes have been applied as reference genes in various fruit trees, including Chinese jujube [5, 6], peach [7, 8], litchi [9], grape [10], citrus [11], apple [12–14], pear [15, 16] and cherry [17]. Only one study has analyzed the reference genes stability for Juglans sigillata Dode [18].…”