Evaluation of Pyrosequencing® technology for the identification of clinically relevant non-dematiaceous yeasts and related species

Montero, Clemente I.; Shea, Yvonne R.; Jones, Peter A.; Harrington, Susan M.; Tooke, Nigel; Witebsky, Frank G.; Murray, Patrick R.

doi:10.1007/s10096-008-0510-x

Cited by 39 publications

(32 citation statements)

References 36 publications

(45 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The ITS sequence analysis confirmed those results. Previously, divergent ITS2 sequences (30 to 35 bp), obtained by pyrosequencing, were reported in some clinical isolates of C. rugosa (2,13). Our studies confirmed such variability and showed that C. pseudorugosa also displays divergence in that fragment, i.e., a different sequence for each isolate (CBS 613 T , GTCAAAAGTGGTTAGTCGGCGA CTTACTTGA; UTHSC 06-3729, GTCGATATTGGTTAGTCTG CGACTTACTTGA; and UTHSC R-3412, GTCAACATCTAAAA GTCGGCGACTTACTTGA), and all were different from those of C. rugosa and C. neorugosa.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Molecular Identification and Antifungal Susceptibility Testing of Clinical Isolates of the Candida rugosa Species Complex and Proposal of the New Species Candida neorugosa

et al. 2012

View full text Add to dashboard Cite

e Candida rugosa is a poorly known fungal species occasionally involved in human infections. A molecular analysis of the sequences of the D1/D2 domains and the internal transcribed spacer (ITS) region of the ribosomal genes of 24 clinical isolates phenotypically identified as C. rugosa demonstrated that only 10 (41.6%) isolates belonged to that species. The other isolates were identified as Candida pararugosa (41.6%) and Candida pseudorugosa (8.3%). The remaining two isolates, from human and equine infections, respectively, were clearly different from the others and represent a new species proposed here as Candida neorugosa. The closest species by D1/D2 sequences was the type strain of C. rugosa, with only 92.3% similarity. C. neorugosa can also be differentiated from all other species of the C. rugosa complex by phenotypic features. The eight antifungal drugs tested showed high in vitro activity against the 24 isolates included in the study.

show abstract

Section: Discussionmentioning

confidence: 99%

“…(23). Some genetic heterogeneity in C. rugosa has been reported (2,13,21), and the novel species Candida pseudorugosa, closely related to C. rugosa, has been recently proposed (11).…”

Section: T He Incidence Of Candida Infection Has Increased In Recent mentioning

confidence: 99%

Molecular Identification and Antifungal Susceptibility Testing of Clinical Isolates of the Candida rugosa Species Complex and Proposal of the New Species Candida neorugosa

et al. 2012

View full text Add to dashboard Cite

show abstract

“…High-throughput sequencing technologies could, and no doubt soon will, be used to investigate the diversity of eukaryotic microbes such as fungi, protists and microalgae in environmental samples through amplification and sequencing of hypervariable regions of ribosomal genes (Montero et al, 2008). Virus genomes lack conserved regions; consequently, metagenomics is necessary to identify the types present (Angly et al, 2006;Fierer et al, 2007).…”

Section: Further Applicationsmentioning

confidence: 99%

The rational exploration of microbial diversity

2008

View full text Add to dashboard Cite

The exploration of the microbial world has been an exciting series of unanticipated discoveries despite being largely uninformed by rational estimates of the magnitude of task confronting us. However, in the long term, more structured surveys can be achieved by estimating the diversity of microbial communities and the effort required to describe them. The rates of recovery of new microbial taxa in very large samples suggest that many more taxa remain to be discovered in soils and the oceans. We apply a robust statistical method to large gene sequence libraries from these environments to estimate both diversity and the sequencing effort required to obtain a given fraction of that diversity. In the upper ocean, we predict some 1400 phylotypes, and a mere fivefold increase in shotgun reads could yield 90% of the metagenome, that is, all genes from all taxa. However, at deep ocean, hydrothermal vents and diversities in soils can be up to two orders of magnitude larger, and hundreds of times the current number of samples will be required just to obtain 90% of the taxonomic diversity based on 3% difference in 16S rDNA. Obtaining 90% of the metagenome will require tens of thousands of times the current sequencing effort. Although the definitive sequencing of hyperdiverse environments is not yet possible, we can, using taxa-abundance distributions, begin to plan and develop the required methods and strategies. This would initiate a new phase in the exploration of the microbial world.

show abstract

“…To overcome the inaccuracies of biochemical identification methods, nucleic acid-based tests have been developed. These tests amplify and then sequence a target gene, such as the rRNA genes or the internal transcribed spacer (ITS) region (9,10,14,17). While these assays are highly accurate, they require considerable processing time and costly reagents.…”

mentioning

confidence: 99%

Evaluation of Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry for Identification of Clinically Important Yeast Species

et al. 2010

View full text Add to dashboard Cite

Evaluation of Pyrosequencing® technology for the identification of clinically relevant non-dematiaceous yeasts and related species

Cited by 39 publications

References 36 publications

Molecular Identification and Antifungal Susceptibility Testing of Clinical Isolates of the Candida rugosa Species Complex and Proposal of the New Species Candida neorugosa

Molecular Identification and Antifungal Susceptibility Testing of Clinical Isolates of the Candida rugosa Species Complex and Proposal of the New Species Candida neorugosa

The rational exploration of microbial diversity

Evaluation of Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry for Identification of Clinically Important Yeast Species

Contact Info

Product

Resources

About