Evaluation of DNA-targeted anti-cancer drugs by Raman spectroscopy

Xie, Wei; Ye, Yong; Shen, Aiguo; Zhou, Li; Lou, Zhaowen; Wang, Xiaohua; Hu, Jiming

doi:10.1016/j.vibspec.2008.03.003

Cited by 34 publications

(30 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…[3,9] Other authors, indicate also the guanine residues as contributors to this vibration. [2,17,25] This band shifted to 1333 cm −1 for DNA isolated from Exacum species and to 1328 cm −1 for DNA extracted from Malus.…”

Section: Resultsmentioning

confidence: 91%

“…[1] However, normal Raman spectroscopy has an extremely small scattering cross section, which limits its use as a low-level bioanalytical sensor. [2,3] Surface-enhanced Raman scattering (SERS) spectroscopy, using silver nanoparticles, has shown promise in overcoming the low-sensitivity problems inherent in Raman spectroscopy. [4] Using the SERS technique, the detection sensitivity is enhanced up to 6-10 orders of magnitude over conventional Raman spectroscopy (Ref.…”

Section: Introductionmentioning

confidence: 99%

“…SERS wavenumbers (cm −1 ) and tentative assignments of genomic DNA from leaves of different plant species[2,3,15,17,19,25] …”

mentioning

confidence: 99%

See 2 more Smart Citations

Surface‐enhanced Raman spectroscopy of genomic DNA from in vitro grown plant species

Muntean

Leopold

Halmágyi

et al. 2011

J Raman Spectroscopy

103

View full text Add to dashboard Cite

Surface-enhanced Raman scattering (SERS) effect was used to demonstrate ultrasensitive optical detection of nucleic acids. In this work, the SERS spectra of seven genomic DNAs from leaves of Arnica montana (L.), Fam. Compositae, Astragalus peterfii (Jáv.), Fam. Fabaceae, Kalanchoe x hybrida, Fam. Crassulaceae, strawberry (Fragaria x ananassa Duch.), Fam. Rosaceae, carnation (Dianthus caryophyllus L.), Fam. Caryophyllaceae, apple (Malus domestica Borkh.), Fam. Rosaceae and Persian violet (Exacum affine Balf.), Fam. Gentianaceae were analyzed in the wavenumber range 200-1800 cm −1 . SERS signatures, spectroscopic band assignments and structural interpretations of these plant genomic DNAs are reported. SERS spectra of nucleic acids are compared here with caution, because these signals are time-dependent. The SERS spectra corresponding to DNA from Arnica, Dianthus, Fragaria and Kalanchoe leaves show well-resolved, accurate bands, providing thus a high molecular structural information content. Based on this work, specific plant DNA-ligand interactions or DNA structural changes induced by plant stress conditions associated with their natural environment might be further investigated using SERS spectroscopy. Besides, this study will generate information that is valuable in the development of label-free DNA-based nanosensors for chemical probing in the living cell.

show abstract

Section: Resultsmentioning

confidence: 91%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Surface‐enhanced Raman spectroscopy of genomic DNA from in vitro grown plant species

Muntean

Leopold

Halmágyi

et al. 2011

J Raman Spectroscopy

103

View full text Add to dashboard Cite

show abstract

“…19 It has the advantage of having minimum interference from water bands which makes it more appropriate for biomedical applications 20 and provides an easy, chemicalfree and nondestructive method for studying cells in vitro, cell drug interactions as well as for distinguishing neoplastic from normal tissues. [21][22][23][24][25][26][27][28][29][30][31][32] Each tumor is composed of several distinct cell populations and thus the potential and e±cacy of chemotherapy is largely governed by the presence of most chemosensitive or rather least resistant cell populations. Identi¯cation of a resistant/sensitive phenotype in cancer cells from the patients can enhance the e±cacy of therapy.…”

Section: Introductionmentioning

confidence: 99%

Investigating the effects of Pentoxifylline on human breast cancer cells using Raman spectroscopy

Goel

Singh

Krishna

et al. 2015

J. Innov. Opt. Health Sci.

View full text Add to dashboard Cite

Breast cancer is one of the leading causes of cancer-related deaths in a global scenario. In the present study, biochemical changes exerted upon Pentoxifylline (PTX) treatment had been appraised in human breast cancer cells using Raman spectroscopy. There are no clinically approved methods to monitor such therapeutic responses available. The spectral pro¯ling is suggestive of changes in DNA, protein and lipid contents showing a linear relationship with drug dosage. Further, multivariate analysis using principal-component based linear-discriminant-analysis (PC-LDA) was employed for classifying the control and the PTX treated groups. These¯ndings support the feasibility of Raman spectroscopy as an alternate/adjunct label-free, objective method for monitoring drug-induced modi¯cations against breast cancer cells.

show abstract

“…However, normal Raman spectroscopy suffers from small scattering cross section, which limits its use as a low-level bioanalytical technique. [6][7][8] In the UV resonance Raman (UVRR) approach, the laser-excitation wavelength is tuned into resonance with the target chromophore, and thereby the resonance-enhanced Raman spectrum of the chromophore is selectively obtained. [9] An additional advantage of the selectivity of UVRR is its sensitivity: because of the large increase in the intensity of scattering due to the electronic resonance, sample concentrations as low as 10 À5 M may be used.…”

Section: Introductionmentioning

confidence: 99%

The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

Muntean

Salehi

Niebling

et al. 2013

J Raman Spectroscopy

View full text Add to dashboard Cite

UV (275 nm) resonance Raman spectra of LacDNA 22-mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAG-CTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn 2+ and Ca 2+ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti-sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned.Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca 2+ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn 2+ and Ca 2+ ) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn 2+ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm À1 .

show abstract

Evaluation of DNA-targeted anti-cancer drugs by Raman spectroscopy

Cited by 34 publications

References 11 publications

Surface‐enhanced Raman spectroscopy of genomic DNA from in vitro grown plant species

Surface‐enhanced Raman spectroscopy of genomic DNA from in vitro grown plant species

Investigating the effects of Pentoxifylline on human breast cancer cells using Raman spectroscopy

The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

Contact Info

Product

Resources

About