Evaluation of Accumulation of Hepatitis C Virus Mutations in a Chronically Infected Chimpanzee: Comparison of the Core, E1, HVR1, and NS5b Regions

Abstract

Four hepatitis C virus genome regions (the core, E1, HVR1, and NS5b) were amplified and sequenced from yearly samples obtained from a chronically infected chimpanzee over a 12-year span. Nucleotide substitutions were found to accumulate in the core, E1, and HVR1 regions during the course of chronic infection; substitutions within the NS5b region were not detected for the first 8 years and were found to be minimal during the last 4 years. The rate of accumulation of mutations in the core and E1 regions, based on a direct comparison between the first 1979 sequence and the last 1990 sequence, was 1.120 ؋ 10 ؊3 , while phylogenetic ancestral comparison using the 12 yearly sequences showed a rate of 0.816 ؋ 10 ؊3 bases per site per year. Temporal evaluation of the sequences revealed that there appeared to be periods in which substitutions accumulated and became fixed, followed by periods with relative stasis or random substitutions that did not persist. Synonymous and nonsynonymous substitutions within the core, E1, and HVR1 regions were also analyzed. In the core and E1 regions, synonymous substitutions predominated and gradually increased over time. However, within the HVR1 region, nonsynonymous substitutions predominated but gradually decreased over time.Hepatitis C virus (HCV), a member of the flavivirus family, is the major causative agent of non-A, non-B hepatitis (3, 4). Genetic diversity of HCV can be categorized into two or three levels. Phylogenetic analysis of HCV sequences has identified six genotypes, or clades, some of which have discrete subtypes (23,25). This level of diversity is the result of mutations during evolution of the virus and generally reflects a variety of geographic regions. In addition, as has been found for most RNA viruses, HCV within an individual is composed of a group of closely related yet heterogeneous sequences (quasispecies) (16). The sequences of the quasispecies cluster around a dominant sequence (master sequence) that is the most abundant sequence in the population. This master sequence may or may not reflect the consensus sequence, which has been defined as the most frequently appearing nucleotide at a given position when a number of genomes in a quasispecies are sequenced (12) and is the sequence identified by direct sequencing of PCR products.A number of studies have addressed the mutation rate of HCV and have estimated its range to be 0.4 ϫ 10 Ϫ3 to 1.92 ϫ 10 Ϫ3 bases per site per year (1,18,20). These studies were based on paired HCV sequences that provided only two points for estimating this rate. The values were obtained by calculating the number of nucleotide differences (direct comparison) between cloned fragments that might not reflect the consensus sequence. In addition, using direct comparison, the earlier sequence is assumed to be the direct ancestor of the later sequence. Since HCV is composed of quasispecies, the two sequences may result from two coevolving variants derived from a common ancestor. If this is the case, the value obtained by direct comparison, u...

Viral RNA Mutations Are Region Specific and Increased by Ribavirin in a Full-Length Hepatitis C Virus Replication System

“…Estimates have ranged from 0.4 ϫ 10 Ϫ3 to 1.9 ϫ 10 (1,20,25,27). The findings in our study suggest that the mutation rate attributable to NS5B miscopying is substantially higher, leading to generation of quasispecies in some regions over a short term.…”

HCV selection and HVR1 evolution in a chimpanzee chronically infected with HCV‐1 over 12 years

“…The latter represent the consensus sequences of the 12 annual samples. These sequences were identical to those directly determined from PCR products (AF268569∼ AF268580) 40 . In addition, 37 (with “ Ch ” initials) and 53 (with “56” initials) sequences (AY190830∼AY190919) of the same nucleotide range were determined.…”

“…A series of archived plasma samples were selected from the same chimpanzee at approximately the same date each year from 1979 to 1990 ( n = 12). Based on these serial samples, the accumulation of HCV mutations in the core, E1 and NS5B regions was evaluated 40 . The remaining cDNAs from the latter study were used as templates in the current study.…”

“…The inner primers were CE‐3 (5′‐ATCTAT CCCGGCCATATAAC‐3′) (nt 1263–1282) and E2 (5′‐TGATGTGCCAACTGCCGTTGGT‐3′) (nt 1608R− 1587R). These primers were used in nested PCR; the PCR products were cloned and sequenced as previously described 38,40 …”

Codon optimization and mRNA amplification effectively enhances the immunogenicity of the hepatitis C virus nonstructural 3/4A gene

“…2 The genetic heterogeneity of HCV is a result of the high viral replication rate of 10 10 -10 13 viral particles daily 3 together with spontaneous nucleotide substitutions of 10 À2 -10 À3 substitutions per nucleotide per year. 4,5 This suggests that vaccine development should be targeted against genetically stable regions of the HCV genome. It has been shown that DNA immunizations can induce both specific antibodies and cell-mediated responses against the structural and nonstructural (NS) HCV proteins in mice.…”