Evaluation of a custom QIAseq targeted DNA panel with 164 ancestry informative markers sequenced with the Illumina MiSeq

Truelsen, Ditte; Freire-Aradas, Ana; Nazari, Majid; Aliferi, Anastasia; Ballard, David J.; Phillips, Christopher; Morling, Niels; Pereira, Vânia; Børsting, Claus

doi:10.1038/s41598-021-99933-2

Cited by 8 publications

(2 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We noticed that a vast majority of the undetermined reads consisted of a specific DNA sequence originating from read 2 (AACTCCATCAATCAGGTCAGTTTCTCACTTTCAAAACGCAATACTGTACATT) with a specific adaptor sequence (CCAGTCGT). Truelsen et al [ 24 ] noticed a similar phenomenon with dimers for low template DNA samples. They diluted the adaptor indices to adjust the number of adaptors when analyzing low levels of DNA, which successfully decreased the adaptor dimers.…”

Section: Discussionmentioning

confidence: 73%

See 1 more Smart Citation

Applying Unique Molecular Indices with an Extensive All-in-One Forensic SNP Panel for Improved Genotype Accuracy and Sensitivity

Staadig

Hedman

Tillmar

2023

Genes

View full text Add to dashboard Cite

One of the major challenges in forensic genetics is being able to detect very small amounts of DNA. Massively parallel sequencing (MPS) enables sensitive detection; however, genotype errors may exist and could interfere with the interpretation. Common errors in MPS-based analysis are often induced during PCR or sequencing. Unique molecular indices (UMIs) are short random nucleotide sequences ligated to each template molecule prior to amplification. Applying UMIs can improve the limit of detection by enabling accurate counting of initial template molecules and removal of erroneous data. In this study, we applied the FORCE panel, which includes ~5500 SNPs, with a QIAseq Targeted DNA Custom Panel (Qiagen), including UMIs. Our main objective was to investigate whether UMIs can enhance the sensitivity and accuracy of forensic genotyping and to evaluate the overall assay performance. We analyzed the data both with and without the UMI information, and the results showed that both genotype accuracy and sensitivity were improved when applying UMIs. The results showed very high genotype accuracies (>99%) for both reference DNA and challenging samples, down to 125 pg. To conclude, we show successful assay performance for several forensic applications and improvements in forensic genotyping when applying UMIs.

show abstract

Section: Discussionmentioning

confidence: 73%

“…A sensitive and accurate detection of low-level DNA variants could potentially be a successful technological improvement for the field of forensic genetics. At present, and as far as we know, only a few studies applying UMI from a forensic perspective have been conducted [ 23 , 24 , 25 ].…”

Section: Introductionmentioning

confidence: 99%

Applying Unique Molecular Indices with an Extensive All-in-One Forensic SNP Panel for Improved Genotype Accuracy and Sensitivity

Staadig

Hedman

Tillmar

2023

Genes

View full text Add to dashboard Cite

show abstract

Feasibility study of a single‐primer extension‐based microhaplotype NGS system

Zhu,

Shu,

Wang

et al. 2024

Electrophoresis

View full text Add to dashboard Cite

DNA degradation has been a thorny problem in forensic science. Shortening the amplicon length of the genetic markers improves the analysis of degraded DNA effectively. Microhaplotype (MH) has been proposed as a potential genetic marker that can be used for degraded DNA analysis. In the present study, a 146‐plex MH‐next‐generation sequencing (NGS) system with an average Ae of 6.876 was constructed. Unlike other MH studies, a single‐primer extension (SPE)‐based NGS library preparation method was used to improve the detection of MH markers for degraded DNA. SPE employs a locus‐specific and universal primer to amplify target fragments, reducing the necessity for complete fragment sequences. SPE might effectively mitigate the impact of degradation on amplification. However, SPE produces amplicons of varying lengths, posing challenges in allele calling for SPE‐NGS data. To address this issue, this study proposed a flexible allele‐calling strategy to improve amplicon detection. In addition, this study evaluated the forensic efficacy of the system using 12 low‐template samples (from 1 ng to 7.8 pg), 10 mock‐degraded DNA with various degrees of degradation, and 8 forensic casework samples. When the template is as low as 7.8 pg, our system can accurately detect at least 37 loci and achieves a random match probability (RMP) of 10−30 using the complete allele‐calling strategy. Eighty‐two loci can be detected, and RMP can reach 10−54 using a flexible allele‐calling strategy. After 150 min of 98°C treatment, 36 loci can still be detected, and an RMP of 10−5 can be obtained using the flexible allele‐calling strategy. Furthermore, the number of single nucleotide polymorphism detected at different DNA amounts and degradation levels suggests that the SPE method combined with a flexible allele‐calling strategy is effective.

show abstract

EASplex: A panel of 308 AISNPs for East Asian ancestry inference using next generation sequencing

Chen¹,

Zhou²,

Zhang³

et al. 2022

Forensic Science International: Genetics

View full text Add to dashboard Cite

Evaluation of a custom QIAseq targeted DNA panel with 164 ancestry informative markers sequenced with the Illumina MiSeq

Cited by 8 publications

References 49 publications

Applying Unique Molecular Indices with an Extensive All-in-One Forensic SNP Panel for Improved Genotype Accuracy and Sensitivity

Applying Unique Molecular Indices with an Extensive All-in-One Forensic SNP Panel for Improved Genotype Accuracy and Sensitivity

Feasibility study of a single‐primer extension‐based microhaplotype NGS system

EASplex: A panel of 308 AISNPs for East Asian ancestry inference using next generation sequencing

Contact Info

Product

Resources

About