Evaluating the Protective Properties of a Xyloglucan-Based Nasal Spray in a Mouse Model of Allergic Rhinitis

Abstract

A breached nasal epithelial barrier plays an important role in driving allergic rhinitis (AR). Corticosteroids remain the standard of care (SoC) but come with side effects, thus alternative safe and effective treatments able to avoid inflammation and restore barrier integrity are needed. The aim of the present study is to evaluate the barrier-forming capacity of a xyloglucan-based nasal spray (XG) and compare its efficacy to several SoC treatments (corticosteroid spray, oral mast-cell stabilizer and oral antihistamine) in reducing allergic responses in addition to its effect when concomitantly administered with an antihistamine. An ovalbumin (OVA)-induced mouse AR model was used. XG shows a significant efficacy in reducing histological damage in AR mice; improves nasal rubbing and histamine-induced hyper-responsiveness. Total and OVA-specific IgE as well as pro-inflammatory cytokines are significantly reduced compared to OVA challenged-mice, with im-proved efficacy when used as an add-on treatment. However, XG reduces mucous secreting cells (PAS-positive) and mucin mRNA expression similar to the corticosteroid-treated mice. XG-spray maintains tight junction protein expression (ZO-1) and conversely decreases HDAC1 significantly; the latter being highly expressed in AR patients. Moreover, the concomitant treatment showed in all of the endpoints a similar efficacy to the corticosteroids. This innovative approach may represent a novel therapeutic strategy for nasal respiratory diseases like AR, reducing undesirable side effects and improving the quality of life in patients.

Ulva pertusa, a Marine Green Alga, Attenuates DNBS-Induced Colitis Damage via NF-κB/Nrf2/SIRT1 Signaling Pathways

“…ELISA kits were used to detect the levels of IL-5 (#BMS610), IL-13 (#BMS6015), IL-9 (#88-8092), IL-4 (#BMS613), GSH (#MBS266871), CAT (#MBS160589), SOD (#MBS034842), caspase-3 (#MBS849298-100), caspase-9 (#LS-F21324), and caspase-8 (#LS-F32785) in serum or colon tissues of mice as previously described [ 32 , 33 ], and according to the manufacturer’s protocols.…”

Efficacy of an oral suspension containing xyloglucan and pea proteins on a murine model of gastroesophageal reflux disease

“…β-actin mRNA was used as an endogenous sham to allow for the relative quantification. RT-qPCR was made for the evaluation of Mucin 5 AC (MUC5AC) gene expression (5 0 CCAGCACCATCTCTACAACCC 3 0 and 3 0 GCAAAGCTCCTGTTTGCACTC 5 0 ) using Power Up Sybr Master Mix (Applied Biosystems, Carlsbad, CA, USA) and a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA) (Lanza et al, 2021). The amplified PCR products were quantified by measuring the calculated cycle thresholds (CT) of target genes and β-actin mRNA.…”

Updated epithelial barrier dysfunction in chronic rhinosinusitis: Targeting pathophysiology and treatment response of tight junctions

“…40,130,131 Major protease components derived from HDM, such as Der p 1, have been demonstrated to directly disrupt the integrity of ZO-1, occludin, JAM-A, and claudin-1 in order to facilitate nasal epithelial leakage. [132][133][134] Moreover, both HDM 72,73,82,135 and ovalbumin (OVA) [136][137][138][139][140][141] were found to disrupt the nasal epithelial barrier function ex vivo. Regarding plant allergens, Fukuoka et al 142 suggested that Japanese cedar and ragweed could reduce ZO-1 expression and increase permeability through the Cystatin SN pathway in RPMI2650 cells and BALB/c mice.…”

“…73,82 Additionally, Budesonide also alleviated nasal epithelial barrier dysfunction induced by TNF, 168 PM 2.5 , 144 and OVA. 138 Although it remains unclear whether dexamethasone (Dex) can effectively alleviate symptoms in CRS, there is evidence suggesting that Dex can reverse the impairment of TJs in IL-13-induced primary HNECs 93 and PM 10 -induced RPMI2650 cells. 146,147 Meanwhile, oral administration 136 and nasal aerosol inhalation 146,147 while preventing ZO-1 degradation in the nasal epithelium of OVAinduced AR mice.…”