EuPathDB: The Eukaryotic Pathogen Genomics Database Resource

Abstract

The Eukaryotic Pathogen Genomics Database Resource (EuPathDB, http://eupathdb.org) is a collection of databases covering 170+ eukaryotic pathogens (protists & fungi), along with relevant free-living and non-pathogenic species, and select pathogen hosts. To facilitate the discovery of meaningful biological relationships, the databases couple preconfigured searches with visualization and analysis tools for comprehensive data mining via intuitive graphical interfaces and APIs. All data are analyzed with the same workflows, including creation of gene orthology profiles, so data are easily compared across data sets, data types and organisms. EuPathDB is updated with numerous new analysis tools, features, data sets and data types. New tools include GO, metabolic pathway and word enrichment analyses plus an online workspace for analysis of personal, non-public, large-scale data. Expanded data content is mostly genomic and functional genomic data while new data types include protein microarray, metabolic pathways, compounds, quantitative proteomics, copy number variation, and polysomal transcriptomics. New features include consistent categorization of searches, data sets and genome browser tracks; redesigned gene pages; effective integration of alternative transcripts; and a EuPathDB Galaxy instance for private analyses of a user's data. Forthcoming upgrades include user workspaces for private integration of data with existing EuPathDB data and improved integration and presentation of host-pathogen interactions.

Genomic and transcriptomic evidence for descent from Plasmodium and loss of blood schizogony in Hepatocystis parasites from naturally infected red colobus monkeys

“…Hepatocystis contigs were identified by comparison of sequences with Plasmodium and Macaca mulatta reference genomes using Diamond, Minimap2 and BLAST, similarly to what is described in the section "Separation of Hepatocystis and Piliocolobus scaffolds". Further decontamination was done using Diamond and BLAST searches against 19747 sequences from Ascomycota and 165860 bacterial sequences downloaded from UniProt (release 2019_10) [ 106 ] and 3 Babesia proteomes from PiroplasmaDB (release 46) [ 107 ]. Selected contigs were also checked with BLAST against the NCBI nt database.…”

Fussing About Fission: Defining Variety Among Mainstream and Exotic Apicomplexan Cell Division Modes

“…We identified five B. bigemina IMC proteins by reciprocal BLASTP searches on EuPathDB (Warrenfeltz et al, 2018) with the 14 T. gondii alveolin-domain containing IMC proteins (Anderson-White et al, 2011): PiroplasmaDB.org accession number BBBOND_0204530, BBBOND_0401990, BBBOND_0201220, BBBOND_0208040, BBBOND_0300730). B. bigemina BBBOND_0204530, which we named BbIMC1a, was most conserved and the whole ORF of 600 bp was synthesized by TwistBioscience (San Francisco, CA), amplified with primers #4831 pAVA-Gibson-Twist-F gaagctcagacccaggg and #4832 pAVA-Gibson-Twist-R tgcagaacttgttcgtgctg to remove the linkers and cloned by Gibson assembly into PmeI/NruI digested plasmid pAVA0421 (Alexandrov et al, 2004), expressed as a 6-His tag fusion in Escherichia coli BL21-RIPL, purified by Ni-NTA chromatography under denaturing conditions (Invitrogen), refolded, and used to immunize a guinea pig (Covance, Inc.).…”

Transcriptional remodeling during metacyclogenesis in Trypanosoma cruzi I

“…The gene IDs for down-and upregulated DEGs, obtained from both Cufflink and DESeq2, were submitted to the EupathDB TriTrip online tool in two different lists to obtain the gene ontology (GO) terms for enrichment analysis [53,54]. To reconstruct protein pathways, a FASTA output file was obtained from the IDs of the down-and upregulated DEGs submitted to EupathDB with protein-coding sequences.…”