Eteplirsen in the treatment of Duchenne muscular dystrophy

Abstract

Duchenne muscular dystrophy is a fatal neuromuscular disorder affecting around one in 3,500–5,000 male births that is characterized by progressive muscular deterioration. It is inherited in an X-linked recessive fashion and is caused by loss-of-function mutations in the DMD gene coding for dystrophin, a cytoskeletal protein that stabilizes the plasma membrane of muscle fibers. In September 2016, the US Food and Drug Administration granted accelerated approval for eteplirsen (or Exondys 51), a drug that acts to promote dystrophin production by restoring the translational reading frame of DMD through specific skipping of exon 51 in defective gene variants. Eteplirsen is applicable for approximately 14% of patients with DMD mutations. This article extensively reviews and discusses the available information on eteplirsen to date, focusing on pharmacological, efficacy, safety, and tolerability data from preclinical and clinical trials. Issues faced by eteplirsen, particularly those relating to its efficacy, will be identified. Finally, the place of eteplirsen and exon skipping as a general therapeutic strategy in Duchenne muscular dystrophy treatment will be discussed.

Timing and localization of human dystrophin isoform expression provide insights into the cognitive phenotype of Duchenne muscular dystrophy

“…Studies have shown altered cerebral blood flow in DMD, but the mouse models used in these studies did not have mutations that were predicted to affect Dp71 of Dp40 52 . Clinical trials for DMD include strategies that aim to restore functional dystrophin protein targeting transcript pre-mRNA splicing or translations [53][54][55][56][57] . In order to restore function of dystrophin in the brain, compounds need to cross the blood-brain-barrier (BBB), which is not the case for all.…”

Employment of Microencapsulated Sertoli Cells as a New Tool to Treat Duchenne Muscular Dystrophy

“…Instead, patients treated with Eteplirsen revealed an increased number of dystrophin-positive myofibers compared with placebo-treated patients, and improvement in functional tests [35] so that the US FDA accelerated the approval of this drug on September 2016. Eteplirsen has been used with good results also in patients carrying mutations in exon 53 in Japan [36]. However, the use of AONs have some aspects to be improved, such as the poor tissue uptake and the relative low rescue of dystrophin expression.…”

We Should Continue the Half-Century History of Applications of Antisense Oligonucleotides in Medicine, Agriculture and Forestry: A Mini-Review

“…DMD is a progressive, disabling genetic neuromuscular disorder, occurring only in males, caused by an absence of dystrophin, with an incidence of 1 in 3,500-5,000 males born worldwide [77,78]. This absence is the result of mutations in a gene coding for dystrophin [79,80], a membrane-associated protein that forms a network with sarcolemmal glycoproteins by linking the cytoskeletal actin in muscle fibers with the surrounding extracellular matrix [81]. In children affected by DMD, the disorder begins within the first few months of life, causing the development of muscle weakness.…”

“…By hybridizing to exon 51 of DMD, the drug causes the exon to be skipped during splicing [82,83], correcting the translational reading frame. This leads to production of shortened, functional dystrophin proteins [79].…”

“…Eteplirsen, a phosphorodiamidate morpholino oligomer 30 nucleotides in length [79], with the sequence CTCCAACATCAAGGAAGATGGCATTTCT [82], is administered via intravenous infusion and was found to be well tolerated, with no adverse effects, in several clinical trials [79].…”