Establishment and cytological characteristics of two <i>in vitro</i> T‐cell lines derived from a child with acute lymphatic leukemia and a man with adult T‐cell leukemia in Japan

Nagasaka, Miharu; Maeda, Sakan; Mabuchi, Osamu; Takubo, Takayuki; Nasu, K; Wano, Yuji; Sugiyama, Taketoshi

doi:10.1002/ijc.2910300208

Cited by 23 publications

(9 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As shown in Table I, all 3 ATL cell lines established in our laboratory shared the common phenotypic characteristics of ATL cells which correspond to the findings of the other investigators (Miyoshi et al, 1980;Nagasaka et al, 1982;Hoshino et al, 1983), with the exception of IL-2-R expression. All cell lines grew constantly and have been maintained until now by subcultivation every week after more than 2 years' cultivation.…”

Section: Cell-sur3race Phenotypes Of Atl Cell Lines and Changes In Thsupporting

confidence: 88%

IL‐2‐ and IL‐2‐R‐ independent proliferation of T‐cell lines from adult T‐cell leukemia/lymphoma patients

Katoh

Harada

Morkawa

et al. 1986

Intl Journal of Cancer

View full text Add to dashboard Cite

Human T-cell leukemia/lymphoma virus I (HTLV-I) is known to be associated with adult T-cell leukemia/lymphoma (ATL) as an etiological agent. The mechanism of leukemogenesis by HTLV, however, is still obscure. Two hypotheses have been proposed concerning abnormalities in IL-2 production and its receptor (Tac antigen) expression based on the experimental observations of IL-2-dependent ATL cell lines. In this study, we examine these hypotheses by using 3 leukemic T-cell lines from 3 Japanese patients with ATL. These cell lines were cultivated and established without addition of IL-2 to the culture medium. Cell-surface phenotype analysis by immunofluorescence with monoclonal antibodies (MAbs) and IL-2 binding assays revealed that one of the ATL cell lines, HPB-ATL-2, expresses only a minimal amount of IL-2 receptor (IL-2-R) on the cell surface and binds less radiolabelled human recombinant IL-2 than the other highly Tac-positive cell lines. Expression of Tac antigen in all ATL cell lines was not affected by IL-2, anti-Tac MAb or the tumor-promoter phorbol ester in the culture medium. The culture supernatant from these cell lines showed no IL-2 activity toward Con-A-stimulated human peripheral blood lymphocytes, and their growth was not affected by additional IL-2 in cultures. IL-2-independent growth and constitutive expression of its receptors on the cell surface were evident in our ATL cell lines. However, dense expression of IL-2 receptors was not essential for stimulation of leukemic proliferation of T cells by HTLV-I. Trans-activation of the PX40 gene product of HTLV-I for activation of IL-2-R gene might not be coincidentally associated with stimulation for cell proliferation.

show abstract

Section: Cell-sur3race Phenotypes Of Atl Cell Lines and Changes In Thsupporting

confidence: 88%

IL‐2‐ and IL‐2‐R‐ independent proliferation of T‐cell lines from adult T‐cell leukemia/lymphoma patients

Katoh

Harada

Morkawa

et al. 1986

Intl Journal of Cancer

View full text Add to dashboard Cite

show abstract

“…Previously, two cell lines, MT-1 and MT-2, were established by cocultivating leukemic cells of ATL patients with cord leukocytes (18,19). There is also a recent report of establishment of a cell line KH-2 without use of TCGF or coculture (26). However, isolation of a cell line like KH-2 is probably a rare event because we were unable to establish any Tcell line without TCGF.…”

Section: Discussionmentioning

confidence: 86%

Establishment and characterization of 10 cell lines derived from patients with adult T-cell leukemia.

Hoshino¹,

Esumi²,

Misawa³

et al. 1983

Proc. Natl. Acad. Sci. U.S.A.

120

View full text Add to dashboard Cite

By using human T-cell growth factor (TCGF), 10 cell lines were established from tissue samples of 10 patients with adult T-cell leukemia (ATL). Three cell lines were adapted to growth in medium lacking TCGF. The surface markers of all cell lines were characteristic of inducer/helper T cells, i.e., OKT3+, OKT4+, OKT6-, OKT8-, OKIa1+, and human Lyt2+ and Lyt3+, except that one cell line was OKT3-. The expression of the viral antigen was examined during establishment of 8 of the 10 cell lines. The viral antigen was not expressed in leukemic cells before cultivation. In 5 lines, the viral antigen was detected by immunofluorescent staining after a short period of cultivation. However, 3 cell lines, ATL-6A, ATL-9Y, and ATL-1K did not express the viral antigen during short-term culture: the ATL-6A and ATL-9Y cell lines became positive for the viral antigen after 5 and 2 months of cultivation, respectively; the ATL-1K cell line remained antigen-negative throughout a culture period of 13 months. Southern blot hybridization assay showed that all of the cell lines, including the viral antigen-negative ATL-1K cell line, contained the viral genome. Thus, the retrovirus was associated with all 10 cell lines established from ATL patients, but there was a heterogeneity in the expression time of the retroviral antigen in leukemic cells maintained in vitro. Our findings suggested that the expression of the viral antigen was not required for maintenance of the leukemic state in vivo and for growth of leukemic cells in vitro.

show abstract

“…ISH was done on semiserial sections using digoxigenin (DIG)‐labeled single‐stranded DNA probe as described 15 . Total RNA extracted from the ATL cell line 16 with the RNA extraction system, RNAzol (TEL‐TEST, INC., Friendswood, TX, USA), was used as a template for RT‐PCR. A 249‐bp cDNA from the coding region of human PTHrP was amplified by RT‐PCR with rTth reverse transcriptase (Perkin‐Elmer Cetus, Norwalk, CT, USA) using the following pair of primers as described: 17 sense primer: 5′‐CGATTCTTCCTTCACCATCT‐3′, antisense primer: 5′‐TTTCTTTTCCTGCTCCTTGC‐3′.…”

Section: Methodsmentioning

confidence: 99%

Expression of parathyroid hormone‐related protein (PTHrP) in multiple myeloma

Kitazawa

Kajimoto

et al. 2002

Pathology International

Self Cite

View full text Add to dashboard Cite

Multiple myeloma is a plasma cell neoplasia often associated with multiple skeletal lesions and hypercalcemia. Several cytokines, including interleukin (IL)-1, IL-6 and tumor necrosis factor-beta (TNF-beta), derived from myeloma cells are thought to accelerate osteoclastic bone resorption and cause hypercalcemia through a paracrine mechanism. We report on a case of a 69-year-old man with multiple myeloma associated with hypercalcemia and advanced osteolytic lesions. After bisphosphonate treatment and MP (melphalan and prednisolone) therapy, the patient's serum calcium level was successfully but transiently recovered to the normal range. Biochemical analysis showed a remarkable increase in serum parathyroid hormone-related protein (PTHrP; 3.7 pmol/L) and IL-6 (22.0 pg/mL). On the other hand, parathyroid hormone and 1alpha,25(OH)2 vitamin D3 were suppressed. By immunohistochemistry and in situ hybridization on aspiration-biopsied bone marrow clot sections, PTHrP mRNA and protein were detected in the cytoplasm of myeloma cells. The rate of PTHrP-positive myeloma cells was estimated to be at least one-third. Since PTHrP can, as an endocrine factor, systemically act on bone and kidney, hypercalcemia in this case might have been caused through both local osteolytic hypercalcemia and humoral hypercalcemia of malignancy mechanisms.

show abstract

Establishment and cytological characteristics of two in vitro T‐cell lines derived from a child with acute lymphatic leukemia and a man with adult T‐cell leukemia in Japan

Cited by 23 publications

References 29 publications

IL‐2‐ and IL‐2‐R‐ independent proliferation of T‐cell lines from adult T‐cell leukemia/lymphoma patients

IL‐2‐ and IL‐2‐R‐ independent proliferation of T‐cell lines from adult T‐cell leukemia/lymphoma patients

Establishment and characterization of 10 cell lines derived from patients with adult T-cell leukemia.

Expression of parathyroid hormone‐related protein (PTHrP) in multiple myeloma

Contact Info

Product

Resources

About