Establishment and characterization of a novel orthotopic mouse model for human uterine sarcoma with different metastatic potentials

Kawabe, Shinya; Mizutani, Tetsuya; Ishikane, Shin; Martínez, Miguel E.; Kiyono, Yasushi; Miura, Koichi; Hosoda, Hiroshi; Imamichi, Yoshitaka; Kangawa, Kenji; Miyamoto, Kaoru; Yoshida, Yoshio

doi:10.1016/j.canlet.2015.06.018

Cited by 7 publications

(11 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Kawabe et al developed a uterine sarcoma tissue‐derived orthotopic and metastatic mouse model using a green fluorescent protein stably expressed uterine sarcoma cell. They also identified the differential expression of genes related to cell proliferation and migration ( TNNT1 , COL1A2 and ZIC1 ) between orthotopic tumors with high and low metastatic potential . Animal models are indispensable tools for the study of u‐LMS because a real clinical sample makes large‐scale analysis of human samples challenging.…”

Section: Uterine Leiomyosarcomamentioning

confidence: 99%

“…Recently, some researchers reported extremely interesting studies . They investigated the gene expression patterns of primary and metastatic lesions in patients and in vivo with distant metastatic u‐LMS, and they identified genes that were overexpressed in each type of lesion.…”

Section: Uterine Leiomyosarcomamentioning

confidence: 99%

“…Recently, some researchers reported extremely interesting studies. 11,43,44 They investigated the gene expression patterns of primary and metastatic lesions in patients and in vivo with distant metastatic u-LMS, and they identified genes that were overexpressed in each type of lesion. Several genes, which are listed along with their functions in Table 2, are overexpressed at primary lesion sites, and the following genes were overexpressed or down underexpressed in metastatic lesions.…”

Section: Molecular Biomarker Candidates For Diagnosis and Prognosismentioning

confidence: 99%

See 2 more Smart Citations

Molecular biomarkers for uterine leiomyosarcoma and endometrial stromal sarcoma

Tsuyoshi

Yoshida

2018

Cancer Science

Self Cite

View full text Add to dashboard Cite

Uterine leiomyosarcoma (u‐LMS) and endometrial stromal sarcoma (ESS) are among the most frequent soft tissue sarcomas, which, in adults, lead to fatal lung metastases and patients have an extremely poor prognosis. Due to their rarity and heterogeneity, there are no suitable biomarkers for diagnosis and prognosis, although some biomarker candidates have appeared. In 2017, The Cancer Genome Atlas (TCGA) Research Network's work on u‐LMS has confirmed mutations and deletions in RB1,TP53 and PTEN. In addition, whole‐exome sequencing of u‐LMS has confirmed and demonstrated frequent alterations in TP53,RB1, α‐thalassemia/mental retardation syndrome X‐linked (ATRX) and mediator complex subunit 12 (MED12). MED12 is a useful biomarker to diagnose uterine‐derived LMS and tumors arising from (LM) with a relatively favorable prognosis. TP53 and ATRX mutations can be important mechanisms in the pathogenesis of u‐LMS and are correlated with a poor prognosis. In an update based on the 2014 WHO classification, low‐grade ESS is often associated with gene rearrangement bringing about the JAZF 1‐SUZ12 (formerly JAZF1‐JJAZ1) fusion gene, whereas high‐grade ESS is associated with the YWHAE‐NUTM fusion gene. Low‐grade ESS with JAZF1 rearrangement may correlate with metastasis. However, high‐grade ESS with metastasis with YWHAE rearrangement shows a relatively favorable prognosis. The genetic/molecular genetic aberrations in u‐LMS and ESS are reviewed, focusing on molecular biomarkers for these primary and metastatic tumors.

show abstract

Section: Uterine Leiomyosarcomamentioning

confidence: 99%

Section: Uterine Leiomyosarcomamentioning

confidence: 99%

Section: Molecular Biomarker Candidates For Diagnosis and Prognosismentioning

confidence: 99%

See 1 more Smart Citation

Molecular biomarkers for uterine leiomyosarcoma and endometrial stromal sarcoma

Tsuyoshi

Yoshida

2018

Cancer Science

Self Cite

View full text Add to dashboard Cite

show abstract

“…Standard hematoxylin and eosin (H&E)-stained sections (5 μm) were made for microscopic histology evaluation. These tissues were immunohistochemically stained using the avidin-biotin-peroxidase complex technique with an LSAB kit (Dako, Glostrup, Denmark) [ 9 ]. Immunohistochemical staining was performed using primary antibodies to the following proteins, diluted in PBS: P450 aromatase (anti-cytochrome P450 2E1 antibody ab 28146, mouse monoclonal, 1:100, Abcam, Tokyo, Japan); and SF-1 (clone N1665, mouse monoclonal, 1:100, Perseus Proteomics, Tokyo, Japan).…”

Section: Methodsmentioning

confidence: 99%

“…Leiomyosarcoma specimens were used as negative controls. RT-qPCR was performed as described previously [ 9 ]. Primers used for RT-qPCR were as follows: SF-1 (forward), 5′- CATCCTCTTCAGCCTGGATTTG-3′ and SF-1 (reverse), 5′-CCTTCTCCTGAGCGTCTTTCAC-3′; CYP19A1 (forward), 5′- TAGCAGAGAAACGTGGTGAC -3′ and CYP19A1 (reverse), 5′- GAGACAGACATGGTGTCAGG -3′; ACTB (forward), 5′- GGACTTCGAGCAAGAGATGG -3′ and ACTB (reverse), 5′- AAGGAAGGCTGGAAGAGTGC -3′.…”

Section: Methodsmentioning

confidence: 99%

Ovarian mucinous adenocarcinoma with functioning stroma in postmenopausal women: aromatase and SF-1 expressions

Hattori¹,

Yamada²,

Yamamoto

et al. 2015

J Ovarian Res

Self Cite

View full text Add to dashboard Cite

BackgroundA high serum estradiol (E2) level is occasionally detected in postmenopausal women with common epithelial ovarian tumors with functioning stroma. It has been proven that functioning stroma has the capacity to convert androgens to estrogens. However, the mechanism of the initiation and development of functioning stroma remains unclear.Case PresentationWe present two cases of elevated E2 levels in elderly women with ovarian mucinous adenocarcinomas that contained functioning stroma. Immunohistochemical evaluation revealed high expression levels of aromatase and steroidogenic factor-1 (SF-1), which is considered to be a master regulator of steroidogenesis, in their ovarian stroma.ConclusionsThese cases suggest that overexpression of SF-1 may promote estrogen biosynthesis through regulation of P450 aromatase expression in ovarian tumors with functioning stroma; this in turn induces high serum E2 levels in postmenopausal women with common epithelial ovarian tumors.

show abstract

Troponin T1 silencing inhibits paclitaxel resistance and the development of breast cancer via suppressing rat sarcoma virus/rapidly accelerated fibrosarcoma 1 pathway

Zhu,

Zhou,

Yang

et al. 2023

Environmental Toxicology

View full text Add to dashboard Cite

ObjectiveWe aimed to determine the role of Troponin T1 (TNNT1) in paclitaxel (PTX) resistance and tumor progression in breast cancer (BC).MethodsDifferentially expressed genes were obtained from the GSE4298 and GSE90564 datasets. Hub genes were isolated from protein–protein interaction networks and further validated by real‐time quantitative polymerase chain reaction. The effect of TNNT1 on PTX resistance was determined using cell counting kit‐8, 5‐ethynyl‐2′‐deoxyuridine, wound healing, transwell, flow cytometry assays, and subcutaneous xenografted tumor model. Western blotting was used to detect proteins associated with PTX resistance, apoptosis, migration, invasion, and other key pathways. Hematoxylin–eosin and immunohistochemical staining were used to evaluate the role of TNNT1 in tumors.ResultsAfter comprehensive bioinformatic analysis, we identified CCND1, IGF1, SFN, INHBA, TNNT1, and TNFSF11 as hub genes for PTX resistance in BC. TNNT1 plays a key role in BC and is upregulated in PTX‐resistant BC cells. TNNT1 silencing inhibited PTX resistance, proliferation, migration, and invasion while promoting apoptosis of PTX‐resistant BC cells. Tumor xenograft experiments revealed that TNNT1 silencing suppresses PTX resistance and tumor development in vivo. In addition, TNNT1 silencing inhibited the expression of proteins in the rat sarcoma virus (RAS)/rapidly accelerated fibrosarcoma1 (RAF1) pathway in vivo. Treatment with a RAS/RAF1 pathway activator reversed the inhibitory effect of TNNT1 silencing on proliferation, migration, and invasion while promoting apoptosis of PTX resistance BC cells.ConclusionSilencing of TNNT1 suppresses PTX resistance and BC progression by inhibiting the RAS/RAF1 pathway, which is a promising biomarker and therapeutic target for drug resistance in BC.

show abstract

Establishment and characterization of a novel orthotopic mouse model for human uterine sarcoma with different metastatic potentials

Cited by 7 publications

References 23 publications

Molecular biomarkers for uterine leiomyosarcoma and endometrial stromal sarcoma

Molecular biomarkers for uterine leiomyosarcoma and endometrial stromal sarcoma

Ovarian mucinous adenocarcinoma with functioning stroma in postmenopausal women: aromatase and SF-1 expressions

Troponin T1 silencing inhibits paclitaxel resistance and the development of breast cancer via suppressing rat sarcoma virus/rapidly accelerated fibrosarcoma 1 pathway

Contact Info

Product

Resources

About