Escaping the Cut by Restriction Enzymes Through Single-Strand Self-Annealing of Host-Edited 12-bp and Longer Synthetic Palindromes

Abstract

Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5¢ CCCGAATTCGGG 3¢, (2) by a 22-bp related sequence 5¢ CTCGTGCCGAATTCGGCACGAG 3¢, and (3) by a longer 44-bp related sequence: 5¢ CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3¢. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand ( + ) is single-strand self-annealed; (2) the recognition site for the minus strand ( -) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5¢ G/AATTC 3¢, its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

The Quantum Workings of the Rotating 64-Grid Genetic Code

“…In this number of NeuroQuantology, Negadi takes a “quantum-like” approach to find relational patterns in the number of atoms and nucleons within codons, their amino acids and precursors, as well as their water-interactions and the symmetrical importance of serine (Negadi, 2011); these studies, added to my upcoming research on the reciprocal folding(Castro-Chavez, 2011c) of complementary codons within the 64-grid genetic code, will certainly inject novelty to future strategies for better ‘information-rich’ comparisons of genes and sequences in bioinformatics (my second working article is: "The three binary annealing representations of the genetic code as seen in the primeval I Ching of Fu-Xi and the directionality of its resulting Yin/Yang components").…”

Most Used Codons per Amino Acid and per Genome in the Code of Man Compared to Other Organisms According to the Rotating Circular Genetic Code

“…These findings can be clearly differentiated from methodological artifacts reported elsewhere (Castro-Chavez, 2005, 2012b), “ which are products of the methodologies used, such as the host-vector interactions leading to an artificial rearrangement-splicing ” (Castro-Chavez, 2004). …”

Defragged Binary I Ching Genetic Code Chromosomes Compared to Nirenberg's and Transformed into Rotating 2D Circles and Squares and into a 3D 100% Symmetrical Tetrahedron Coupled to a Functional One to Discern Start From Non-Start Methionines through a Stella Octangula

“…In this work, synthetic, heterogeneous and quasi-identical genetic code chromosomes (m, M, M' and i, I, I') have been presented (with M' and I' exhibiting an additional semi-introversion plus an integration of the codons for essential hydrophobic amino acids with T at their center), being this a positive theoretical use for the single-strand self-annealing; however, in a previous work, I have experimentally demonstrated its negative side because there, synthetic single-strand self-annealed palindromes that are real products of molecular methodologies, are also resistant to digestion by restriction enzymes, and are currently contaminating millions of nucleic acids that are present in databases such as the Genbank [48]; such negative single-strand self-annealing is the opposite of the theoretical positive basis for the defragging by pairing presented here for the genetic code; and as said at the beginning, all the analyses done here used only the coding strand, while it is assumed that the non-coding strand is hidden below or behind the coding strand that is shown.…”