Erwinia amylovora strains from outbreaks of fire blight in Spain: phenotypic characteristics

Abstract

One hundred and thirty strains of Erwinia amylovora recovered from Spanish foci of fire blight from 1995 to 2000 were characterised and compared to reference strains from different sources and origins. Their rapid identification was performed by double antibody sandwich indirect (DASI) ELISA, using specific monoclonal antibodies against E. amylovora, and molecular confirmation by PCR using primers specific to the native plasmid pEA29. The Spanish strains of E. amylovora grew on different general and selective media producing typical colonies, except one of them that was deficient in levan production, whereas none of them grew on minimal agar medium with copper sulphate and low content of asparagine. All of them were susceptible to tetracycline, streptomycin, kasugamycin and oxolinic acid. Biochemical characterisation of selected strains by API 20E system revealed a great homogeneity, with 80% of the Spanish strains showing one of the two majority API 20E profiles described for E. amylovora, and the remaining strains showing minor differences. Pathogenicity on pear fruits and hypersensitivity reaction was confirmed, but a delayed reaction was observed for two Spanish strains. This is the first characterisation of a large collection of Spanish strains of E. amylovora.

Exploring diversity of Erwinia amylovora population in Serbia by conventional and automated techniques and detection of new PFGE patterns

“…Using two tubes per strain in two independent experiments, one strain was negative and three strains hydrolysed gelatin slower than the rest of the tested strains. Variability in gelatin hydrolysis for E. amylovora was already reported (Billing et al 1961;Donat et al 2005). Moreover, in API 20E test Donat el al.…”

Survival Strategy of Erwinia amylovora against Copper: Induction of the Viable-but-Nonculturable State

“…Passe Crassane) and immature loquat fruits (2-cm diameter; Eriobotrya japonica cv. Tanaka) as previously described (3,10). Thus, for the two assayed strains, aliquots of 50 l from each container with E. amylovora cells under different copper concentrations were inoculated on three pears and four loquats in duplicate in two independent experiments.…”

Characterizationof Moroccan Population of ErwiniaAmylovora, the Causal Agent of Fire Blighton Rosacea

“…The bacterial strains are identified by the Polymerize chain reaction (PCR) analysis was performed with a multiple xPCR: Peant1/2 (TATCCCTAAAAAACCTCAGT GC/GCAACCTTGTGCCCTTTA) [15], pEA71F/R (CCTGCATAAATCACCGCTGACAGCTCAATG/GCTAC CACTGATCGCTCGAATCAAATCGGC) [16] and EaIscF/R (CGCTAACAGCAGATCGCA/AAATACGCGCACGACC AT) [17]. The three primers specific selected of DNA of Erwinia amylovora, that two primers plamid's detecting pEA 29 and pEa71 and the third chromosome's DNA, first Each PCR mixture was carried out in a total volume of 20µl contained 5X PCR buffer GoTaq Flexi (4μl), 2.5 mM (1.5μl) of dNTP, 25mM MgCl2 (1.2 µl), 10μM each primer (0.25μl), 5U Taq (0.05µl) Polymerase (Promega, USA), and 50 ng of DNA template (1µl).…”