Epizootic Haemorrhagic Disease Virus Serotype 8 in Tunisia, 2021

Abstract

Epizootic haemorrhagic disease (EHD) is a Culicoides-borne viral disease caused by the epizootic haemorrhagic disease virus (EHDV) associated with clinical manifestations in domestic and wild ruminants, primarily white-tailed deer (Odocoileus virginianus) and cattle (Bos taurus). In late September 2021, EHDV was reported in cattle farms in central/western Tunisia. It rapidly spread throughout the country with more than 200 confirmed outbreaks. We applied a combination of classical and molecular techniques to characterize the causative virus as a member of the serotype EHDV-8. This is the first evidence of EHDV- 8 circulation since 1982 when the prototype EHDV-8 strain was isolated in Australia. This work highlights the urgent need for vaccines for a range of EHDV serotypes.

Epizootic Hemorrhagic Disease Virus: Current Knowledge and Emerging Perspectives

“…In Australia, six out of seven serotypes (EHDV-1, -2, -5, -6, -7, and -8) have been detected over the years [ 35 , 40 ]. Globally, the presence of EHDV has been noted in Japan (serotypes 2 and 7, and serotypes 5 and 6 recently isolated from Culicoides insect vectors), China (serotypes 1, 5, 6, 7, 8), Morocco (serotype 6), Algeria (serotype 6), Libya (serotype 6), Turkey (serotype 6), Tunisia (serotypes 6 and 8), Egypt (serotype 1), Oman (serotype 2 and 6), Sudan (serotype 5 and 6), Nigeria (serotypes 1 and 4), the island of Mayotte (serotype 6), French Guiana (serotypes 6 and 7), Ecuador (serotype 1), Trinidad (serotype 6) and Israel (serotypes 1, 6 and 7) [ 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 , 57 , 58 , 59 ]. Genome detection or serological evidences also indicate the presence of EHDV (unknown serotypes) in Indonesia, Taiwan, Zimbabwe, Kenya, Kazakhstan, and Brazil [ 60 , 61 , 62 , 63 , 64 ].…”

Epizootic Hemorrhagic Disease Virus Serotype 8, Italy, 2022

“…Confirmation of novel Orbivirus incursion into the EU sustained by EHDV-8 was predictable, considering the distribution of this virus in Tunisia and likely in neighboring countries ( 8 ). On November 18, 2022, EHD was also reported in the Andalusia region of Spain, in the cities of Cadiz and Seville.…”

“…We describe detection of EHDV serotype 8 (EHDV-8) in cattle in Italy, as a follow-up to our previous studies on EHDV-8 (GenBank accession nos. OP381190–9) in Tunisia in 2021 ( 8 ).…”

“…We tested 1 EDTA blood sample per animal and spleen samples for EHDV RNA by using a VetMAX EHDV Kit (Thermo Fisher Scientific, https://www.thermofisher.com ). We developed a real-time reverse transcription PCR (rRT-PCR) specific for the S2 of the EHDV-8 strain detected in Tunisia in 2021 (EHDV-8 TUN 2021) because the available test designed for the S2 segment of the EHDV-8 reference serotype (isolated in Australia in 1982) did not detect EHDV-8 TUN 2021 ( 8 ). Primer nucleotide sequences were EHDV_Ser8varNEW_fwd AGAGATGAAGATCGCGAGGA and EHDV_Ser8varNEW_rev GAATCACACGCGCTCACTAA; the probe nucleotide sequence was EHDV_Ser8varNEW_Probe FAM-ACGGATGAGATACGGAACATACGGGG-TAMRA.…”

“…We tested serum samples collected from all animals with a competitive ELISA, ID Screen EHDV Competition (Innovative Diagnostics, https://www.innovative-diagnostics.com ), and by virus neutralization ( 10 ). We attempted virus isolation by using rRT-PCR–positive blood samples on Vero cells ( 8 ).…”