Epithelial Colonies Cultured from Human Explanted Liver in Subacute Hepatic Failure Exhibit Hepatocyte, Biliary Epithelial, and Stem Cell Phenotypic Markers

Abstract

The liver in subacute hepatic failure may become enriched for hepatic progenitor cells. Liver tissue from such a patient was collagenase digested and, from the nonparenchymal cell fraction, epithelioid colonies were developed. Albumin and alpha-1-antitrypsin (AAT) were secreted for greater than 120 days from these colonies. Reverse transcription-polymerase chain reaction showed expression of markers of both hepatocyte and biliary epithelial phenotypes (cytokeratins 7, 18, and 19, albumin and AAT, hepatocyte growth factor receptor, transforming growth factor beta receptor type II, gamma-glutamyl transpeptidase, biliary glycoprotein). The cell cycle regulator p21 was also expressed. The POU domain transcription factor octamer-binding protein 4 was present in these cells, but not in RNA or cDNA prepared from adult human liver. These markers were maintained even after 165 days culture. Proliferating epithelial-like cells with combined hepatocyte-and biliary-epithelial-specific functional markers and a stem cell marker can be isolated from the nonparenchymal fraction of liver cells in subacute hepatic failure. Stem

Efficient human fetal liver cell isolation protocol based on vascular perfusion for liver cell-based therapy and case report on cell transplantation

“…Little is known about whether CD90/Thy-1, which has been described for adult hepatic progenitors in rodents, [63][64][65] characterizes human hepatic progenitors (as described in 1 case 50 ), although it is often not found in the human liver. 34,48,66 Nava et al 26 could not find CD90 in human fetal hepatic progenitors from the first trimester, but they did find it in cells from the second trimester that coexpressed CD90 and hepatic markers (as we found in low percentages for the late second trimester). In contrast, Fiegel et al 64 found CD90 expression during all stages of rat liver development but at higher levels only in the early developmental stages.…”

“…33,[40][41][42] Because of their availability, most studies of the isolation and in vitro propagation of adult liver progenitors have been performed with animal-derived cells, 40 and the majority of the isolation strategies for liver progenitors are based on the in vivo activation of the progenitor cell population 43 followed by the enzymatic digestion of tissue fragments and the selection of progenitors with a variety of techniques, such as centrifugation techniques, fluorescence-activated cell sorting, 46 and selective cell aggregate formation. 47 Approaches to the isolation of adult progenitors from normal human livers are rarely described; cell harvesting after the collagenase digestion of tissue fragments is performed with various methods, including differential centrifugation, 48 magnetic or fluorescence-activated cell sorting, 33,49 and selective conditions for liver cell cultures. 50 Typically, these methods result in low cell numbers.…”

Side Population Cells Derived from Adult Human Liver Generate Hepatocyte-like Cells In Vitro

“…Both adult and fetal liver have long been considered to harbor hepatic progenitor cells because of anatomical homology, and several studies have now substantiated this hypothesis. Adult human liver-derived progenitor cells have exhibited both hepatocytic and biliary markers upon differentiation (16,29). Hepatoblasts isolated from human fetal liver in the second trimester that expressed biliary (CK-19) and hepatocyte (glycogen) markers at initial isolation eventually expressed markers for both hepatocytes (albumin) and biliary epithelium (GGT) (30).…”

“…To identify liver markers (15)(16)(17), the cDNA was amplified by use of a GeneAmp PCR System 9700 Cycler (PE Applied Biosystems) under the following conditions: human albumin (forward, 5′-TTGGAAAAATCCCACTGCAT; reverse, 5′-CTCC AAGCTGCTCAAAAAGC), at 95°C for 120 sec, followed by 35 cycles at 94°C for 0 sec and 72°C for 20 sec; human cytokeratin 18 (CK-18: forward, 5′-GAGATCGAGGCTCTCAAGGA; reverse, 5′-CAAGCTGGCCTTCAGATTTC), at 95°C for 120 sec, followed by 40 cycles at 94°C for 0 sec, 58°C for 5 sec, and 72°C for 20 sec; α-1 antitrypsin (AAT: forward, 5′-AGACCCTTTGAAGTCAAGGACACCG; reverse, 5′-CCATTGCTGAAGACCTTAGTGATGC), at 95°C for 15 min, 94°C for 30 sec, 68°C for 30 sec, and 72°C for 1 min, followed by 40 cycles at 72°C for 10 min ; and human cytochrome P450 enzyme (CYP2B6: forward, 5′-GATCACACCATATCCCCGGA; reverse, 5′-CACCCTACCACCCATGACCG), for 40 cycles at 95°C for 15 sec, 60°C for 30 sec, and 72°C for 30 sec. For universal control, human glyceraldehyde 3-phosphate dehydrogenase (GAPDH: forward, 5′-GTC TTCTCCACCATGGAGAAGGCT; reverse, 5′-CATGCCAGTGAG CTTCCCGTTCA) at 95°C for 120 sec, followed by 30 cycles at 94°C for 0 sec, 58°C for 5 sec, and 72°C for 16 sec.…”

Epithelial cells with hepatobiliary phenotype: Is it another stem cell candidate for healthy adult human liver?

“…Following cellular loss, fully differentiated hepatocytes and biliary epithelial cells can proliferate and completely repair the liver [5][6][7][8] . When proliferation of these cells is impaired during chronic or extensive damage of the liver, non-parenchymal epithelial progenitor cells, expressing both biliary and hepatocytic phenotypes, are activated and participate in liver regeneration [9][10][11] . Studies using hepato-toxins or chemical carcinogens treated animal models, revealed the existence of oval cells in the canals of Hering [12][13][14] .…”