Epithelial cells are the major site of hydroxysteroid (17β) dehydrogenase 2 and androgen receptor expression in fetal mouse lungs during the period overlapping the surge of surfactant

Plante, Julie; Simard, Marc; Rantakari, Pia; Côté, Mélissa; Provost, Pierre R.; Poutanen, Matti; Tremblay, Yves

doi:10.1016/j.jsbmb.2009.08.006

Cited by 23 publications

(21 citation statements)

References 36 publications

(49 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Androgens mediate their effects via androgen receptors (ARs). AR immunoreactivity was detected during a critical time period in fetal lung branching morphogenesis in the epithelia of the budding component [91,92]. AR expression was also reported in both normal and malignant human lung cells from adults [93].…”

Section: Androgen Receptors In Neoplastic and Non-neoplastic Human Lumentioning

confidence: 78%

Sex steroid receptors in human lung diseases

Verma

Miki

Sasano

2011

The Journal of Steroid Biochemistry and Molecular Biology

View full text Add to dashboard Cite

Section: Androgen Receptors In Neoplastic and Non-neoplastic Human Lumentioning

confidence: 78%

Sex steroid receptors in human lung diseases

Verma

Miki

Sasano

2011

The Journal of Steroid Biochemistry and Molecular Biology

View full text Add to dashboard Cite

“…All the major sex steroid receptors have been found in the alveolar epithelial layer from biopsy samples (Ishibashi et al, 2005; Marquez-Garban et al, 2009; Mikkonen et al, 2010). Additionally, the enzymes aromatase and 17β-hydroxysteroid dehydrogenase are localized to alveolar epithelium (Marquez-Garban et al, 2009; Plante et al, 2009), indicating that local effects and metabolism of sex steroids may be important.…”

Section: Sex Steroids and Their Receptors In The Lungmentioning

confidence: 99%

Sex steroid signaling: Implications for lung diseases

Sathish

Martin

Prakash

2015

Pharmacology & Therapeutics

137

134

View full text Add to dashboard Cite

There is increasing recognition that the sex hormones (estrogen, progesterone, and testosterone) have biological and pathophysiological actions in peripheral, non-reproductive organs, including the lung. Clinically, sex differences in the incidence, morbidity and mortality of lung diseases such as asthma, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, lung cancer and pulmonary hypertension have been noted, although intrinsic sex differences vs. the roles of sex steroids are still not well-understood. Accordingly, it becomes important to ask the following questions: 1) Which sex steroids are involved? 2) How do they affect different components of the lung under normal circumstances? 3) How does sex steroid signaling change in or contribute to lung disease, and in this regard, are sex steroids detrimental or beneficial? As our understanding of sex steroid signaling in the lung improves, it is important to consider whether such information can be used to develop new therapeutic strategies to target lung diseases, perhaps in both sexes or in a sex-specific manner. In this review, we focus on the basics of sex steroid signaling, and the current state of knowledge regarding how they influence structure and function of specific lung components across the life span and in the context of some important lung diseases. We then summarize the potential for sex steroids as useful biomarkers and therapeutic targets in these lung diseases as a basis for future translational research in the area of gender and individualized medicine.

show abstract

“…DNA matrix for SP6 and T7 polymerases were prepared by PCR amplification of each of the subcloned amplicon with the oligonucleotides GGATTTAGGTGACACTATAGAATA and TAATACGACTCACTATAGGGAGAC, which overlap the 5' end of the SP6 and the T7 promoters, respectively. Then, RNA probes were prepared using digoxigenin (DIG)-UTP substrate (Roche Diagnostics, Qc, Canada) and SP6 (sense) or T7 (antisense) RNA polymerases (Roche Diagnostics), as previously described [30]. ISH was performed as reported [30] except that denatured DIG-cRNA probes were used at 5 ng/μl.…”

Section: Methodsmentioning

confidence: 99%

“…Then, RNA probes were prepared using digoxigenin (DIG)-UTP substrate (Roche Diagnostics, Qc, Canada) and SP6 (sense) or T7 (antisense) RNA polymerases (Roche Diagnostics), as previously described [30]. ISH was performed as reported [30] except that denatured DIG-cRNA probes were used at 5 ng/μl. Slides were counterstained with 0.25% neutral red.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Apolipoprotein C-II and lipoprotein lipase show a temporal and geographic correlation with surfactant lipid synthesis in preparation for birth

et al. 2010

Self Cite

View full text Add to dashboard Cite

BackgroundFatty acids are precursors in the synthesis of surfactant phospholipids. Recently, we showed expression of apolipoprotein C-II (apoC-II), the essential cofactor of lipoprotein lipase (LPL), in the fetal mouse lung and found the protein on the day of the surge of surfactant synthesis (gestation day 17.5) in secretory granule-like structures in the distal epithelium. In the present study, we will answer the following questions: Does apoC-II protein localization change according to the stage of lung development, thus according to the need in surfactant? Are LPL molecules translocated to the luminal surface of capillaries? Do the sites of apoC-II and LPL gene expression change according to the stage of lung development and to protein localization?ResultsThe present study investigated whether the sites of apoC-II and LPL mRNA and protein accumulation are regulated in the mouse lung between gestation day 15 and postnatal day 10. The major sites of apoC-II and LPL gene expression changed over time and were found mainly in the distal epithelium at the end of gestation but not after birth. Accumulation of apoC-II in secretory granule-like structures was not systematically observed, but was found in the distal epithelium only at the end of gestation and soon after birth, mainly in epithelia with no or small lumina. A noticeable increase in surfactant lipid content was measured before the end of gestation day 18, which correlates temporally with the presence of apoC-II in secretory granules in distal epithelium with no or small lumina but not with large lumina. LPL was detected in capillaries at all the developmental times studied.ConclusionsThis study demonstrates that apoC-II and LPL mRNAs correlate temporally and geographically with surfactant lipid synthesis in preparation for birth and suggests that fatty acid recruitment from the circulation by apoC-II-activated LPL is regionally modulated by apoC-II secretion. We propose a model where apoC-II is retained in secretory granules in distal epithelial cells until the lumina reaches a minimum size, and is then secreted when the rate of surfactant production becomes optimal.

show abstract

Epithelial cells are the major site of hydroxysteroid (17β) dehydrogenase 2 and androgen receptor expression in fetal mouse lungs during the period overlapping the surge of surfactant

Cited by 23 publications

References 36 publications

Sex steroid receptors in human lung diseases

Sex steroid receptors in human lung diseases

Sex steroid signaling: Implications for lung diseases

Apolipoprotein C-II and lipoprotein lipase show a temporal and geographic correlation with surfactant lipid synthesis in preparation for birth

Contact Info

Product

Resources

About