Epigenetic Histone Modification of Epstein-Barr Virus BZLF1 Promoter during Latency and Reactivation in Raji Cells

The lytic cycles of Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated herpesvirus (KSHV) are induced in cell culture by sodium butyrate (NaB), a short-chain fatty acid (SCFA) histone deacetylase (HDAC) inhibitor. Valproic acid (VPA), another SCFA and an HDAC inhibitor, induces the lytic cycle of KSHV but blocks EBV lytic reactivation. To explore the hypothesis that structural differences between NaB and VPA account for their functional effects on the two related viruses, we investigated the capacity of 16 structurally related short-and medium-chain fatty acids to promote or prevent lytic cycle reactivation. SCFAs differentially affected EBV and KSHV reactivation. KSHV was reactivated by all SCFAs that are HDAC inhibitors, including phenylbutyrate. However, several fatty acid HDAC inhibitors, such as isobutyrate and phenylbutyrate, did not reactivate EBV. Reactivation of KSHV lytic transcripts could not be blocked completely by any fatty acid tested. In contrast, several medium-chain fatty acids inhibited lytic activation of EBV. Fatty acids that blocked EBV reactivation were more lipophilic than those that activated EBV. VPA blocked activation of the BZLF1 promoter by NaB but did not block the transcriptional function of ZEBRA. VPA also blocked activation of the DNA damage response that accompanies EBV lytic cycle activation. Properties of SCFAs in addition to their effects on chromatin are likely to explain activation or repression of EBV. We concluded that fatty acids stimulate the two related human gammaherpesviruses to enter the lytic cycle through different pathways. IMPORTANCELytic reactivation of EBV and KSHV is needed for persistence of these viruses and plays a role in carcinogenesis. Our direct comparison highlights the mechanistic differences in lytic reactivation between related human oncogenic gammaherpesviruses. Our findings have therapeutic implications, as fatty acids are found in the diet and produced by the human microbiota. Small-molecule inducers of the lytic cycle are desired for oncolytic therapy. Inhibition of viral reactivation, alternatively, may prove useful in cancer treatment. Overall, our findings contribute to the understanding of pathways that control the latent-to-lytic switch and identify naturally occurring molecules that may regulate this process.

Section: Discussionmentioning

confidence: 99%

Activation and Repression of Epstein-Barr Virus and Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycles by Short- and Medium-Chain Fatty Acids

Gorres

Daigle

Mohanram

et al. 2014

“…Primer sequences used in reverse transcription-PCR (RT-PCR) analysis were as follows: for BPLF1, 5=-GGA CCA TGG ATG TGA ATG C-3= (forward) and 5=-GAG TCG GAT GTG AAA GAT CG-3= (reverse); for BZLF1, 5=-AAC AGC CAG AAT CGC TGG AG-3= (forward) and 5=-GGC ACA TCT GCT TCA ACA GG-3= (reverse); and for GAPDH, 5=-TGC ACC ACC AAC TGC TAG C-3= (forward) and 5=-GGC ATG GAC TGT GGT CAT GAG-3= (reverse) (45).…”

Section: Methodsmentioning

confidence: 99%

Epstein-Barr Virus Deubiquitinase Downregulates TRAF6-Mediated NF-κB Signaling during Productive Replication

Saito

Murata

Kanda

et al. 2013

Self Cite

Epstein-Barr virus (EBV), a human oncogenic herpesvirus that establishes a lifelong latent infection in the host, occasionally enters lytic infection to produce progeny viruses. The EBV oncogene latent membrane protein 1 (LMP1), which is expressed in both latent and lytic infection, constitutively activates the canonical NF-κB (p65) pathway. Such LMP1-mediated NF-κB activation is necessary for proliferation of latently infected cells and inhibition of viral lytic cycle progression. Actually, canonical NF-κB target gene expression was suppressed upon the onset of lytic infection. TRAF6, which is activated by conjugation of polyubiquitin chains, associates with LMP1 to mediate NF-κB signal transduction. We have found that EBV-encoded BPLF1 interacts with and deubiquitinates TRAF6 to inhibit NF-κB signaling during lytic infection. HEK293 cells with BPLF1-deficient recombinant EBV exhibited poor viral DNA replication compared with the wild type. Furthermore, exogenous expression of BPLF1 or p65 knockdown in cells restored DNA replication of BPLF1-deficient viruses, indicating that EBV BPLF1 deubiquitinates TRAF6 to inhibit NF-κB signal transduction, leading to promotion of viral lytic DNA replication.

“…Total cell RNA was purified using the TriPure isolation reagent (Roche) and subjected to reverse transcription and real-time PCRs by using a One-Step SYBR PrimeScript RT-PCR Kit II (TaKaRa) and a real-time PCR System 7300, as described previously (53), except that the 40-s extension period at 60 o C was extended to 70 s for detecting long species of LMP1 mRNA expressed from the TR-L1 promoter. The primers used for the qRT-PCR of the GAPDH, BZLF1, and EBNA2 genes were as follows: GAPDH, (TGCACCACCAA CTGCTTAGC and GGCATGGACTGTGGTCATGAG), BZLF1 (AAC AGCCAGAATCGCTGGAG and GGCACATCTGCTTCAACAGG), and EBNA2 (TTAGAGAGTGGCTGCTACGCATT and TCACAAATCACCT GGCTAAG).…”

Section: Methodsmentioning

confidence: 99%

Induction of Epstein-Barr Virus Oncoprotein LMP1 by Transcription Factors AP-2 and Early B Cell Factor

Murata

Noda

Narita

et al. 2016

Self Cite

Latent membrane protein 1 (LMP1) is a major oncogene essential for primary B cell transformation by Epstein-Barr virus (EBV).Previous studies suggested that some transcription factors, such as PU.1, RBP-J, NF-B, and STAT, are involved in this expression, but the underlying mechanism is unclear. Here, we identified binding sites for PAX5, AP-2, and EBF in the proximal LMP1 promoter (ED-L1p). We first confirmed the significance of PU.1 and POU domain transcription factor binding for activation of the promoter in latency III. We then focused on the transcription factors AP-2 and early B cell factor (EBF). Interestingly, among the three AP-2-binding sites in the LMP1 promoter, two motifs were also bound by EBF. Overexpression, knockdown, and mutagenesis in the context of the viral genome indicated that AP-2 plays an important role in LMP1 expression in latency II in epithelial cells. In latency III B cells, on the other hand, the B cell-specific transcription factor EBF binds to the ED-L1p and activates LMP1 transcription from the promoter. IMPORTANCE Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) is crucial for B cell transformation and oncogenesis of other EBVrelated malignancies, such as nasopharyngeal carcinoma and T/NK lymphoma.Its expression is largely dependent on the cell type or condition, and some transcription factors have been implicated in its regulation. However, these previous reports evaluated the significance of specific factors mostly by reporter assay. In this study, we prepared point-mutated EBV at the binding sites of such transcription factors and confirmed the importance of AP-2, EBF, PU.1, and POU domain factors. Our results will provide insight into the transcriptional regulation of the major oncogene LMP1. The Epstein-Barr virus (EBV) is a human gammaherpesvirus that mainly infects and establishes latent infection in B lymphocytes, but it can also infect other types of cells, including NK, T, and epithelial cells. EBV infection has been implicated as a causal factor in a variety of malignancies, and the expression pattern of viral latent genes varies depending on the tissue of origin and the state of the tumors. Neoplasms such as Burkitt lymphomas or gastric carcinomas express only EBV-encoded small RNA (EBER) and EBV nuclear antigen 1 (EBNA1) (type I latency), whereas some Hodgkin lymphomas, nasopharyngeal carcinomas (NPC), and NK/T lymphomas express EBER, EBNA1, latent membrane protein 1 (LMP1), and LMP2 genes (type II latency). In addition to the type II genes, EBNA2, EBNA3, and EBNA-LP are also expressed in immunosuppression-related lymphomas or lymphoblastoid cell lines (LCLs; type III latency). LMP1 constitutively activates cellular signaling through NF-B, mitogen-activated protein, JAK/STAT, and AKT and is believed to be a major oncogene encoded by EBV (1-11).Two promoters regulate LMP1 gene transcription, with mechanisms that differ between type II and type III infection. In latency III in B lymphocytes, LMP1 transcription from the proximal ED-L1 promoter is acti...