Epigenetic DNA Methylation of Antioxidative Stress Regulator NRF2 in Human Prostate Cancer

Abstract

Epigenetic control of NRF2, a master regulator of many critical anti-oxidative stress defense genes in human prostate cancer (CaP) is unknown. Our previous animal study found decreased Nrf2 expression through promoter CpG methylation/histone modifications during CaP progression in TRAMP mice. In this study, we evaluated CpG methylation of human NRF2 promoter in 27 clinical CaP samples and in LNCaP cells using MAQMA analysis and bisulfite genomic DNA sequencing. Prostate cancer tissue microarray (TMA) containing normal and prostate cancer tissues were studied by immunohistochemistry. Luciferase reporter assay using specific human NRF2 DNA promoter segments and ChIP assay against histone modifying proteins were performed in LNCaP cells. Three specific CpG sites in the NRF2 promoter were found to be hypermethylated in clinical CaP samples (BPH<ADT-RCaP<AS-CaP). NRF2 staining in human CaP TMA showed a decreasing trend for both intensity and percentage of positive cells from normal tissues to advanced-stage CaP (Gleason score from 3–9). Reporter assays in the LNCaP cells containing these three CpG sites showed methylation inhibited transcriptional activity of the NRF2 promoter. LNCaP cells treated with 5-aza/TSA restored the expression of NRF2 and NRF2 downstream target genes, decreased expression levels of DNMT and HDAC proteins, and ChIP assays showed increased RNA Pol II and H3Ac with a concomitant decrease in H3K9me3, MBD2 and MeCP2 at CpG sites of human NRF2 promoter. Taken together, these findings suggest that epigenetic modification may contribute to the regulation of transcription activity of NRF2, which could be employed as prevention and treatment target of human CaP.

Fucoxanthin Elicits Epigenetic Modifications, Nrf2 Activation and Blocking Transformation in Mouse Skin JB6 P+ Cells

“…Hypermethylation in the first five CpG sites was observed, and, on average, 90.1% of these five CpG sites were in the Nrf2 promoter region, which is consistent with previous reports. We previously reported that 5-aza, a DNMT inhibitor, and TSA, an HDAC inhibitor, in combination decreased the CpG methylation levels in the Nrf2 gene promoter region in murine prostate cancer TRAMP C1 cells and human prostate cancer LNCaP cells (69, 70). …”

“…The bisulfite conversion of the genomic DNA was performed using the EZ DNA Methylation Gold Kit (Zymo Research Corp, Irvine, CA) according to the manufacturer’s instructions as previously described (69). The converted DNA was amplified by PCR using the Platinum PCR SuperMix (Invitrogen, Carlsbad, CA) with primers designed for the Nrf2 gene promoter region that spanned the methylated CpG sites from −1226 to −1069, with the translational start site (TSS) referenced as +1, as previously described (70). The sequences of the primers were 5’- AGTAGTAAAAATATTTTTTTAGTTGGAGGT-3’ (sense), 5’ ATATAATCTCATAAAACCCCACCTCT-3’ (antisense), and ATTTTTTTAGTTGGAGGTTATT (sequencing).…”

The Keap1–Nrf2 pathway: promising therapeutic target to counteract ROS-mediated damage in cancers and neurodegenerative diseases

“…Therefore, this leads to the expression of Nrf2 (Wang et al 2008;Muscarella et al 2011). Conversely, DNA methylation by DNA methyltransferases (DNMTs) appears to downregulate the Nrf2 expression indirectly (Khor et al 2014;Yu et al 2010;Rajabi et al 2016;Tagde et al 2016b). (c) Accumulation of p21 and p62 disrupts the Nrf2-Keap1 complex: it has been demonstrated that p53 negatively regulates Nrf2 and specifically suppresses the transcription of target genes of Nrf2 (Faraonio et al 2006).…”

Epigenetic regulation of Keap1-Nrf2 signaling

“…Yu et al identified CpG islands in the promoter regions of human, rat, and mouse NFE2L2 genes and demonstrated that the suppression of Nrf2 expression in TRAMP prostate tumors and TRAMP C1 cells was mediated by the hypermethylation of specific CpG sites in the Nrf2 promoter [41, 42]. Further study by Khor et al using human prostate cancer samples identified three specific CpG sites in the Nrf2 promoter that were hypermethylated during prostate cancer progression [43]. Moreover, treatment of TRAMP cells with the DNMT inhibitor 5-aza-2′-deoxycytidine (5-aza) and the HDAC inhibitor trichostatin A (TSA) could restore Nrf2 expression, which was accompanied by the dissociation of MBD2, MeCP2, and methylated histones [42].…”