Enzymatic Properties of Human Na,K-ATPase α1β3Isozyme

Yu, Chuliang; Xie, Zijian; Askari, Amir; Modyanov, Nikolaï N.

doi:10.1006/abbi.1997.0255

Cited by 22 publications

(27 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Similar to our observations, after expression in Xenopus oocytes, Torpedo ␣1-mouse ␤2 complexes (28) or Bufo ␣1-Xenopus ␤3 complexes (22) expressed in Xenopus oocytes had only slightly lower K ϩ affinities than ␣1-␤1 complexes. Furthermore, human ␣1-␤3 complexes expressed in Sf9 cells showed a similar K ϩ activation than ␣1-␤1 complexes (17). On the other hand, data on rat isozymes, which by themselves are controversial, are difficult to reconcile with our data.…”

Section: Nak-atpase Isozymescontrasting

confidence: 76%

“…The full-length human ␤3 cDNA was identified in the IMAGE Consortium clone number 133072 obtained from Research Genetics (Huntsville, AL) by restriction mapping and sequencing as described (17). To generate the pSD5 vector covering the entire ␤3 coding region preceded by Xe 5Ј-UT, the AlwnI-EcoRV fragment containing the coding region (without 36 nt at the 5Ј end) and 15 nt of the 3Ј-UT, and a synthetic oligonucleotide linker which was designed to encode the first 12 amino acids and fit NcoI and AlwnI sites (sense strand of 37 nt and antisense strand of 30 nt), were ligated with the vector preliminary digested with NcoI and SmaI.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Transport and Pharmacological Properties of Nine Different Human Na,K-ATPase Isozymes

Crambert¹,

Hasler²,

Beggah³

et al. 2000

Journal of Biological Chemistry

Self Cite

395

378

View full text Add to dashboard Cite

Na,K-ATPase plays a crucial role in cellular ion homeostasis and is the pharmacological receptor for digitalis in man. Nine different human Na,K-ATPase isozymes, composed of 3 ␣ and ␤ isoforms, were expressed in Xenopus oocytes and were analyzed for their transport and pharmacological properties. According to ouabain binding and K ؉ -activated pump current measurements, all human isozymes are functional but differ in their turnover rates depending on the ␣ isoform. On the other hand, variations in external K ؉ activation are determined by a cooperative interaction mechanism between ␣ and ␤ isoforms with ␣2-␤2 complexes having the lowest apparent K ؉ affinity. ␣ Isoforms influence the apparent internal Na ؉ affinity in the order ␣1 > ␣2 > ␣3 and the voltage dependence in the order ␣2 > ␣1 > ␣3. All human Na,K-ATPase isozymes have a similar, high affinity for ouabain. However, ␣2-␤ isozymes exhibit more rapid ouabain association as well as dissociation rate constants than ␣1-␤ and ␣3-␤ isozymes. Finally, isoformspecific differences exist in the K ؉ /ouabain antagonism which may protect ␣1 but not ␣2 or ␣3 from digitalis inhibition at physiological K ؉ levels. In conclusion, our study reveals several new functional characteristics of human Na,K-ATPase isozymes which help to better understand their role in ion homeostasis in different tissues and in digitalis action and toxicity.

show abstract

Section: Nak-atpase Isozymescontrasting

confidence: 76%

Section: Methodsmentioning

confidence: 99%

Transport and Pharmacological Properties of Nine Different Human Na,K-ATPase Isozymes

Crambert¹,

Hasler²,

Beggah³

et al. 2000

Journal of Biological Chemistry

Self Cite

395

378

View full text Add to dashboard Cite

show abstract

“…9,45 Importantly, all ␣␤ arrangements studied to date (␣1␤1, ␣1␤2, ␣1␤3, ␣2␤1, ␣2␤2, ␣2␤3, ␣3␤1, ␣3␤2, ␣3␤3, ␣4␤1, and ␣4␤3) resulted in catalytically competent enzymes. [45][46][47][48][49][50] This indicates that multiple isozymes of the Na,K-ATPase can operate in the cell; however, it is not known if, in the native tissues, the assembly of certain ␣ with particular ␤ isoforms is regulated to favor formation of some isozymes over others.…”

Section: Isozyme Heterogeneity Of the Nak-atpasementioning

confidence: 97%

Na,K-ATPase Subunit Heterogeneity as a Mechanism for Tissue-Specific Ion Regulation

Blanco

2005

Seminars in Nephrology

264

267

View full text Add to dashboard Cite

“…39) were amplified with primers UHMUF (CATGAGATCTTGAACAGCCATGAGAAGG) and UH-MUB (CTTAAGATCTAGTTTCTATGTTCAGGGT) and cloned at the BglII site of vector pEGFP-N3 (BD Biosciences). In addition, a human ␤ 3 construct was prepared in the same way from plasmid carrying full-length ORF (51). Human rhabdomyosarcoma line RD, C 2C12 mouse myoblasts, HT-29 human colon carcinoma cells, and 3T3 mouse fibroblasts (all from American Type Culture Collection) were grown in glass-bottomed chambers in DMEM supplemented with 10% FCS, 2 mM glutamine, 50 g/l carbenicillin, and 10 g/l tetracyclin.…”

Section: Animals and Tissuesmentioning

confidence: 99%

Accumulation of β_m, a structural member of X,K-ATPase β-subunit family, in nuclear envelopes of perinatal myocytes

Zhao

Pestov²,

Korneenko³

et al. 2004

American Journal of Physiology-Cell Physiology

Self Cite

View full text Add to dashboard Cite

Zhao, Hao, Nikolay B. Pestov, Tatyana V. Korneenko, Mikhail I. Shakhparonov, and Nikolai N. Modyanov. Accumulation of ␤ m, a structural member of X,K-ATPase ␤-subunit family, in nuclear envelopes of perinatal myocytes. Am J Physiol Cell Physiol 286: C757-C767, 2004. First published December 3, 2003 10.1152/ ajpcell.00358.2003.-Recently discovered muscle-specific ␤ m protein is structurally closely related to the X,K-ATPase ␤-subunits. However, it has a number of unique properties such as predominant localization in intracellular stores and lack of association with known X,K-ATPase ␣-subunits on heterologous coexpression. In this study, the primary structure of mouse ␤ m was determined and developmental regulation of the gene (ATP1B4) was analyzed. The expression is first detected at day 14 of gestation, is sharply increased at day 16, and reaches its maximum at day 18. After birth, the expression quickly decreases and is hardly detectable in adult mice. A more detailed subcellular localization study was undertaken, and its results indicate that ␤ m not only is located in sarcoplasmic reticulum but is concentrated in nuclear envelopes of both prenatal and postnatal skeletal muscles. Immunohistochemical studies show that ␤ m is specific to myocytes and, at the subcellular level, many nuclear envelopes are intensively labeled in both fetal and newborn skeletal muscles. Accordingly, ␤ m is detected by immunoblotting in purified nuclei and nuclear membranes from neonatal skeletal muscles. On transfection of human rhabdomyosarcoma cell line RD, green fluorescent proteintagged ␤ m resides intracellularly with significant enrichment in nuclear envelopes, whereas ␤ m with transmembrane domain deleted localizes in both cytoplasm and nucleoplasm. Nuclear ␤ m apparently is not in association with Na,K-ATPase because we never detected its ␣-subunit in myonuclear membranes. These results indicate that ␤ m has a specialized function in mammalian perinatal myocytes, different from functions of other X,K-ATPase ␤-subunits. The unique temporospatial distribution of ␤ m protein expression suggests its important role in development of growing skeletal muscle.ATP1B4; sodium, potassium-adenosine 5Ј-triphosphatase; nuclear membrane; skeletal muscle development AMONG MORE THAN 200 P-ATPases identified in prokaryotes and eukaryotes (1), most enzymes have just a single catalytic subunit. However, the animal X,K-ATPases (Na,K-ATPase, gastric H,K-ATPase, and nongastric H,K-ATPase) contain, in addition to the catalytic ␣-subunit, an accessory ␤-subunit. Although major functions such as ATP binding, phosphorylation, and ion transport are performed by the ␣-subunit, the ␣-␤ interaction is required for maturation, stability, and translocation of the ATPases to plasma membrane (4, 44). Moreover, the ␤-subunit seems to be related to K transport, the unique feature of the X,K-ATPase family members (16, 45). The ␤-subunit is involved in K affinity and cardiac glycoside sensitivity (25, 45). Different ␣-and ␤-isoform combinations exhibit functiona...

show abstract

Enzymatic Properties of Human Na,K-ATPase α1β3Isozyme

Cited by 22 publications

References 40 publications

Transport and Pharmacological Properties of Nine Different Human Na,K-ATPase Isozymes

Transport and Pharmacological Properties of Nine Different Human Na,K-ATPase Isozymes

Na,K-ATPase Subunit Heterogeneity as a Mechanism for Tissue-Specific Ion Regulation

Accumulation of β_m, a structural member of X,K-ATPase β-subunit family, in nuclear envelopes of perinatal myocytes

Contact Info

Product

Resources

About

Enzymatic Properties of Human Na,K-ATPase α1β3Isozyme

Cited by 22 publications

References 40 publications

Transport and Pharmacological Properties of Nine Different Human Na,K-ATPase Isozymes

Transport and Pharmacological Properties of Nine Different Human Na,K-ATPase Isozymes

Na,K-ATPase Subunit Heterogeneity as a Mechanism for Tissue-Specific Ion Regulation

Accumulation of βm, a structural member of X,K-ATPase β-subunit family, in nuclear envelopes of perinatal myocytes

Contact Info

Product

Resources

About

Accumulation of β_m, a structural member of X,K-ATPase β-subunit family, in nuclear envelopes of perinatal myocytes