Environmental DNA metabarcoding as a tool for biodiversity assessment and monitoring: reconstructing established fish communities of north‐temperate lakes and rivers

Abstract

Aim To evaluate the ability of precipitation‐based environmental DNA (eDNA) sample collection and mitochondrial 12S metabarcoding sequencing to reconstruct well‐studied fish communities in lakes and rivers. Specific objectives were to 1) determine correlations between eDNA species detections and known community composition based on conventional field sampling, 2) compare efficiency of eDNA to detect fish biodiversity among systems with variable morphologies and trophic states, and 3) determine if species habitat preferences predict eDNA detection. Location Upper Great Lakes Region, North America. Methods Fish community composition was estimated for seven lakes and two Mississippi River navigation pools using sequence data from the mitochondrial 12S gene amplified from 10 to 50 water samples per waterbody collected in 50‐mL centrifuge tubes at a single time point. Environmental DNA (eDNA) was concentrated without filtration by centrifuging samples to reduce per‐sample handling time. Taxonomic detections from eDNA were compared to established community monitoring databases containing up to 40 years of sampling and a detailed habitat/substrate preference matrix to identify patterns of bias. Results Mitochondrial 12S gene metabarcoding detected 15%–47% of the known species at each waterbody and 30%–76% of known genera. Non‐metric multidimensional scaling (NMDS) assessment of the community structure indicated that eDNA‐detected communities grouped in a similar pattern as known communities. Discriminant analysis of principal components indicated that there was a high degree of overlap in habitat/substrate preference of eDNA‐detected and eDNA‐undetected species suggesting limited habitat bias for eDNA sampling. Main conclusions Large numbers of small volume samples sequenced at the mitochondrial 12S gene can describe the coarse community structure of freshwater systems. However, additional conventional sampling and environmental DNA sampling may be necessary for a complete diversity census.

Leveraging eDNA metabarcoding to characterize nearshore fish communities in Southeast Alaska: Do habitat and tide matter?

“…One clear result in our study was that the 12S primer that we used (Riaz et al, 2011) lacked taxonomic resolution for many local species. Despite this 12S primer providing relatively high resolution for many study regions including freshwater lakes in the midwestern USA (Euclide et al, 2021; Gehri et al, 2021; Pukk et al, 2021; Sard et al, 2019), it was unable to provide species‐level resolution for some of the most important taxa in Alaska waters including Salmoninae (salmon, also documented by Gehri et al, 2021), Gadidae (cods), Sebastinae (rockfish, also documented by Gold et al, 2021 with a different 12S marker), and Pleuronectidae (flatfish). Using broadly targeted 12S fish primers can efficiently assess the presence of diverse fish taxa with a single metabarcoding primer set; however, primers targeted for specific taxa such as Gadidae or Salmoninae should provide higher resolution and potentially more precise estimates of which species from those families are present and their relative abundance.…”

“…Primer sequences are as follows with Illumina tails in bold: Forward: 5′‐ CGACAGGTTCAGAGTTCTACAGTCCGACGATC ACTGGGATTAGATACCCC‐3′, Reverse: 5′‐ GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT TAGAACAGGCTCCTCTAG‐3′. We chose this primer because it has been shown to be effective for assessing fish communities in both freshwater and marine systems (Euclide et al, 2021; Kelly et al, 2014; Sard et al, 2019). PCR reactions were performed in 10 μl volumes using 3 μl of template eDNA and 7 μl of PCR master mix.…”

Evaluating environmental DNA metabarcoding as a survey tool for unionid mussel assessments

“…Interest continues to grow for incorporating eDNA methodology into environmental and biological assessments (Seymour, 2019; Euclide et al, 2021), and thus it is crucial to fully understand how to interpret eDNA metabarcoding datasets. We take advantage of a unique opportunity to examine the efficacy of eDNA metabarcoding to characterise diverse mussel communities by sampling in advance of an extensive mussel retrieval and rescue survey.…”

Leveraging eDNA metabarcoding to characterize nearshore fish communities in Southeast Alaska: Do habitat and tide matter?

“…One clear result in our study was that the 12S primer that we used (Riaz et al, 2011) lacked taxonomic resolution for many local species. Despite the 12S primer providing relatively high resolution for many study regions including freshwater lakes in the midwestern USA (Euclide et al, 2021;Gehri et al, 2021;Pukk et al, 2021;Sard et al, 2019), it was unable to provide species-level resolution for some of the most important taxa in Alaska waters including Salmoninae (salmon, also documented by Gehri et al, 2021), Gadidae (cods), Sebastinae (rockfish, also documented by Gold, Sprague, Kushner, Zerecero Marin, & Barber, 2021 with a different 12S marker), and Pleuronectidae (flatfish). Using broadly targeted 12S primers can efficiently assess the presence of many diverse fish taxa with a single metabarcoding primer set; however, primers targeted for specific taxa such as Gadidae or Salmoninae should provide higher resolution and potentially more precise estimates of which species from those families are present and their relative abundance.…”