EnteropathogenicEscherichia coliand Ulcerative Colitis in Cotton‐Top Tamarins(Saguinus oedipus)

Abstract

The cotton-top tamarin (CTT; Saguinus oedipus) is an endangered New World primate that develops a highly prevalent idiopathic colitis resembling human ulcerative colitis. This study found that enteropathogenic Escherichia coli (EPEC) caused acute colitis in CTTs, which was associated with ulcerative colitis. EPEC clinical isolates revealed localized adherence patterns by HEp-2 assay and were devoid of Shiga-toxin production. Sequencing of the eae gene (GenBank accession no. AF319597) revealed 99.2% identity to sequences of human isolates (GenBank AF116899) and corresponded to the epsilon intimin gene subtype. Detection of intimin sequences by polymerase chain reaction on primary fecal cultures indicated widespread EPEC infection in the CTT colony. Prospective analysis revealed that animals with fecal cultures positive for intimin sequences had a higher frequency of active colitis (75.0% vs. 27.2%; P<.005, chi(2) test) and higher histological scores of colonic inflammation (0.875 vs. 0.455, respectively; P<.05, Mann-Whitney rank sum test).

Characterization of Monkey Enteropathogenic Escherichia coli (EPEC) and Human Typical and Atypical EPEC Serotype Isolates from Neotropical Nonhuman Primates

“…colitis in cotton-top tamarins have been associated with EPEC (26,27,48). However, there are no reports in the literature about the characterization of this potential pathogen in apparently healthy animals, as observed in the present study.…”

“…Thomson and Scheffler (48) reported an outbreak of diarrhea caused by A/E E. coli in marmosets maintained at the Primatology Center. More recently, EPEC was associated with a simian immunodeficiency virus opportunistic infection in rhesus monkeys (27) and with ulcerative colitis in cotton-top tamarins (26).…”

Characterization of the Novel Factor Paa Involved in the Early Steps of the Adhesion Mechanism of Attaching and Effacing Escherichia coli

“…To screen the recombinant phages, a 350-bp PCR fragment derived from the 5Ј end of the paa gene was generated by paa-specific primers M155-F1 (5ЈATGAGGAAACATAATGGCAGG3Ј) and M155-R1 (5ЈTCTGGTCAGGT CGTCAATAC3Ј) annealed at nucleotides 91 to 110 and 428 to 447 of the paa gene, respectively. The 350-bp fragment was then radiolabeled with [␣- 32 P]CTP as a probe by using an oligonucleotide random priming labeling kit (Pharmacia LKB) according to the manufacturer's instructions. Positive plaques were selected and excised with the ExAssist helper phage (M13) and E. coli strain SOLR system according to the Stratagene ZAPII R instruction manual.…”

“…These lesions are characteristic of enteric pathogens such as enteropathogenic E. coli (EPEC), responsible for severe childhood diarrhea in developing countries (14, 38), enterohemorrhagic E. coli (EHEC), causing hemorrhagic colitis and hemolytic-uremic syndrome, a diarrheagenic E. coli strain of rabbits (RDEC-1), strains of Hafnia alvei isolated from children with diarrhea, and Citrobacter rodentium, causing transmissible colonic hyperplasia in mice (4,16,53). A/E lesions have also been associated with diarrhea in different animal species such as rabbits, calves, dogs, cats, lambs, pigs, and tamarins (8,9,22,32,37,55).A/E lesions result from intimate bacterial adherence to the apical surfaces of enterocytes and activation of several chromosomal gene products that interact with components of the host cell, leading to host cell protein phosphorylation, effacement of target brush borders, and disruption of the underlying actin cytoskeleton (11, 38). The genes are clustered in a chromosomal pathogenicity island called the locus of enterocyte effacement (LEE).…”

“…These lesions are characteristic of enteric pathogens such as enteropathogenic E. coli (EPEC), responsible for severe childhood diarrhea in developing countries (14, 38), enterohemorrhagic E. coli (EHEC), causing hemorrhagic colitis and hemolytic-uremic syndrome, a diarrheagenic E. coli strain of rabbits (RDEC-1), strains of Hafnia alvei isolated from children with diarrhea, and Citrobacter rodentium, causing transmissible colonic hyperplasia in mice (4,16,53). A/E lesions have also been associated with diarrhea in different animal species such as rabbits, calves, dogs, cats, lambs, pigs, and tamarins (8,9,22,32,37,55).…”