Enhancing photosynthetic production of ethylene in genetically engineered Synechocystis sp. PCC 6803

The ethylene-forming enzyme (EFE) from Pseudomonas syringae pv. phaseolicola PK2 is a member of the mononuclear non-heme Fe(II)- and 2-oxoglutarate (2OG)-dependent oxygenase superfamily. This enzyme is reported to simultaneously catalyze the conversion of 2OG into ethylene plus three CO2 and the Cδ hydroxylation of L-arginine (L-Arg) while oxidatively decarboxylating 2OG to form succinate and carbon dioxide. A new plasmid construct for expression in recombinant Escherichia coli cells allowed for the purification of large amounts of EFE with greater activity than previously recorded. A variety of assays were used to quantify and confirm the identity of the proposed products, including the first experimental demonstration of L-Δ1-pyrroline-5-carboxylate and guanidine derived from 5-hydroxyarginine. Selected L-Arg derivatives could induce ethylene formation without undergoing hydroxylation, demonstrating that ethylene production and L-Arg hydroxylation activities are not linked. Similarly, EFE utilizes the alternative α-keto acid 2-oxoadipate as a co-substrate (forming glutaric acid) during the hydroxylation of L-Arg, with this reaction unlinked from ethylene formation. Kinetic constants were determined for both the ethylene formation and L-Arg hydroxylation reactions. Anaerobic UV-visible difference spectra were used to monitor the binding of Fe(II) and substrates to the enzyme. Based on our results and what is generally known about EFE and Fe(II)/2OG-dependent oxygenases, an updated model for the reaction mechanism is presented.

show abstract

“…Of particular interest, recombinant organisms producing EFE have been promoted for developing ethylene as a biofuel. 10–13 …”

mentioning

confidence: 99%

Biochemical and Spectroscopic Characterization of the Non-Heme Fe(II)- and 2-Oxoglutarate-Dependent Ethylene-Forming Enzyme from Pseudomonas syringae pv. phaseolicola PK2

Martinez

Hausinger

2016

Biochemistry

View full text Add to dashboard Cite

show abstract

“…PCC 6803 wild-typeProf. X. XuXX76 slr0168 ::Sp r -P cpcB - efe [5]MH013 sll1423 ::Km r (Insertional inactivation)This studyMH015 sll1423 ::Km r (Deletion)This studyMH017 phaAB ::Gm r -P cpcB - ntcA This studyMH021 slr0168 ::Sp r -P cpcB - efe / sll1423 ::Km r This studyMH023 slr0168 ::Sp r -P cpcB - efe / phaAB ::Gm r -P cpcB - ntcA This studyXX109 slr0168 ::Sp r -P cpcB -efe/ sll1981 ::Km r -P cpcB - efe /s lr0370 ::Cm r -P cpcB - efe [5]MH039 slr0168 ::Sp r -P cpcB -efe/ sll1981 ::Km r -P cpcB - efe /s lr0370 ::Cm r -P cpcB - efe / sll1423 ::Gm r This studyMH043 slr0168 ::Sp r -P cpcB -efe/ sll1981 ::Km r -P cpcB - efe /s lr0370 ::Cm r -P cpcB - efe / sll1423 ::Gm r -P cpcB - efe This study Primers (5′→3′) a Detection primers for ntcA site ( slr1423 ) in single-copy efe recombinantsntcA-d1GTTACTCAGCACAACGGGGTCntcA-d2TTGCAGCCCTTCGC CAGCTG GCACGTTCACGGTAATGGGG Pvu IIkan-1CCCCATTACCGTGAACGTGC CAGCTG GCGAAGGGCTGCAA Pvu IIkan-2GCACTGGTCATAGAGGGTGG CAGCTG GCACGACAGGTTTC Pvu IIntcA-d3GAAACCTGTCGTGC CAGCTG CCACCCTCTATGACCAGTGC Pvu IIntcA-d4TAACTGACCCCGCAGAATGGCntcA-x1ATGGATCAGTCCCTAACCCntcA-x2TTAGGTAAACTGTTGACTGAGAGCphaAB-3GCCTTGGGCTAAGTTATTGAGCGphaAB-4TAGGATTCTTGCACAGTACCGC Quantitati...…”

Section: Methodsmentioning

confidence: 99%

“…The supernatant was collected after centrifugation for western blotting analysis, which was performed as described previously [5]. …”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Effects of global transcription factor NtcA on photosynthetic production of ethylene in recombinant Synechocystis sp. PCC 6803

Xie

Zhu

et al. 2017

Biotechnol Biofuels

Self Cite

View full text Add to dashboard Cite

BackgroundCyanobacteria are considered potential photosynthetic microbial cell factories for biofuel and biochemical production. Ethylene, one of the most important organic chemicals, has been successfully synthesized in cyanobacteria by introducing an exogenous ethylene-forming enzyme (Efe). However, it remains challenging to significantly improve the biosynthetic efficiency of cyanobacterial ethylene. Genetic modification of transcription factors is a powerful strategy for reprogramming cellular metabolism toward target products. In cyanobacteria, nitrogen control A (NtcA), an important global transcription regulator of primary carbon/nitrogen metabolism, is expected to play a crucial role in ethylene biosynthesis.ResultsThe partial deletion of ntcA (MH021) enhanced ethylene production by 23%, while ntcA overexpression (MH023) in a single-copy efe recombinant Synechocystis (XX76) reduced ethylene production by 26%. Compared to XX76, the Efe protein content increased 1.5-fold in MH021. This result may be due to the release of the negative regulation of NtcA on promoter PcpcB, which controls efe expression. Glycogen content showed a 23% reduction in MH021, and the ratio of intracellular succinate to 2-oxoglutarate (2-OG) increased 4.8-fold. In a four-copy efe recombinant strain with partially deleted ntcA and a modified tricarboxylic acid (TCA) cycle (MH043), a peak specific ethylene production rate of 2463 ± 219 μL L−1 h−1 OD730−1 was achieved, which is higher than previously reported.ConclusionsThe effects of global transcription factor NtcA on ethylene synthesis in genetically engineered Synechocystis sp. PCC 6803 were evaluated, and the partial deletion of ntcA enhanced ethylene production in both single-copy and multi-copy efe recombinant Synechocystis strains. Increased Efe expression, accelerated TCA cycling, and redirected carbon flux from glycogen probably account for this improvement. The results show great potential for improving ethylene synthetic efficiency in cyanobacteria by modulating global regulation factors.Electronic supplementary materialThe online version of this article (doi:10.1186/s13068-017-0832-y) contains supplementary material, which is available to authorized users.

show abstract

“…After gel purification, each set of fragments of an upstream and downstream homologous region was fused by overlap PCR, and the entire fused fragment was then further amplified by PCR. After the fused fragment was gel purified, an extra adenosine was added to the 3' ends of these fragments and it was then ligated to the pFL-AN-T vector (26), resulting in plasmids pFL-AN2 (Δsps) and pFL-AN4 (ΔggpS), respectively. Because an XbaI restriction site was introduced via the primers during overlap PCR, the selection cassette, if provided with an XbaI site on both ends, can be easily inserted into pFL-AN2 (Δsps) and pFL-AN4 (ΔggpS), resulting in pFL-AN1 (Δsps) and pFL-AN3 (ΔggpS), respectively.…”

Section: Plasmids and Synechocystis Mutants' Constructionmentioning

confidence: 99%

Using Osmotic Stress to Stabilize Mannitol Production in Synechocystis sp. PCC6803

Du²,

Gallego³

et al. 2020

Preprint

View full text Add to dashboard Cite

Abstract Background Mannitol is a C(6) polyol that is used in the food and medical sector as a sweetener and antioxidant, respectively. The sustainable production of mannitol, especially via the direct conversion of CO 2 by photosynthetic cyanobacteria, has become increasingly appealing. However, previous work aiming to achieve mannitol production in the marine Synechococcus sp. PCC 7002 via heterologous expression of mannitol-1-phosphate-5-dehydrogenase ( mtlD ) and mannitol-1-phosphatase ( m1p , in short: a ‘mannitol cassette’), proved to be genetically unstable. Results Here, we explore the stabilizing effect that mannitol production may have on cells faced with osmotic stress, in the freshwater cyanobacterium Synechocystis sp. PCC 6803. We first validated that mannitol can function as a compatible solute in Synechocystis sp. PCC 6803, and in derivative strains in which the ability to produce one or both of the native compatible solutes was impaired. Wild type Synechocystis , complemented with a mannitol cassette, indeed showed increased salt tolerance, which was even more evident in Synechocystis strains in which the ability to synthesize the endogenous compatible solutes was impaired. Next we tested the genetic stability of all these strains with respect to their mannitol productivity, with and without salt stress, during prolonged turbidostat cultivations. The obtained results show that mannitol production under salt stress conditions in the Synechocystis strain that cannot synthesize its endogenous compatible solutes is remarkably stable, while the control strain completely loses this ability in only 6 days. DNA sequencing results of the control groups that lost the ability to synthesize mannitol revealed that multiple types of mutation occurred in the mtlD gene that can explain the disruption of mannitol production. Conclusions Mannitol production in freshwater Synechocsytis sp. PCC6803 confers it with increased salt tolerance. Under this strategy, genetically instability which was the major challenge for mannitol production in cyanobacteria is tackled. This paper marks the first report of both stable mannitol production directly from CO 2 in cyanobacteria, and of the utilization of the response to salt stress as a factor that can stabilize production in a cyanobacterial cell factory.

show abstract

Enhancing photosynthetic production of ethylene in genetically engineered Synechocystis sp. PCC 6803

Cited by 63 publications

References 56 publications

Biochemical and Spectroscopic Characterization of the Non-Heme Fe(II)- and 2-Oxoglutarate-Dependent Ethylene-Forming Enzyme from Pseudomonas syringae pv. phaseolicola PK2

Biochemical and Spectroscopic Characterization of the Non-Heme Fe(II)- and 2-Oxoglutarate-Dependent Ethylene-Forming Enzyme from Pseudomonas syringae pv. phaseolicola PK2

Effects of global transcription factor NtcA on photosynthetic production of ethylene in recombinant Synechocystis sp. PCC 6803

Using Osmotic Stress to Stabilize Mannitol Production in Synechocystis sp. PCC6803

Contact Info

Product

Resources

About