Enhanced reporter gene expression in the rat brain from helper virus-free HSV-1 vectors packaged in the presence of specific mutated HSV-1 proteins that affect the virion

Yang, Tianzhong; Zhang, Guorong; Zhang, Wei; Sun, Minghan; Wang, Xiaodan; Geller, Alfred I.

doi:10.1016/s0169-328x(01)00059-6

Cited by 33 publications

(60 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As the best available assay, the titering was performed on BHK fibroblast cells. These fibroblast cells form a monolayer; in contrast, PC12 cells, and most neuronal cell lines, do not form a monolayer; and the titers obtained on BHK cells are higher than the titers obtained on PC12 cells [47,50]. Expression from these modified neurofilament promoters in fibroblast cells represents ectopic expression; this ectopic expression declines rapidly at longer times after gene transfer (not shown).…”

Section: Identification Of a 12 Kb Fragment From The Th Promoter Thamentioning

confidence: 95%

“…The titers ranged from 1.5 to 4 × 10 6 IVP/ml; specific vector stocks were diluted, as indicated, to a titer of 1.5 × 10 6 (Table 1). Next, we determined the titers of vector genomes (VG/ml) by isolating DNA from these vector stocks and performing PCR using primers from the Lac Z gene [47]. As a measure of the packaging efficiency, for each vector stock, we determined the ratio of physical titer to biological titer (VG/IVP).…”

Section: Identification Of a 12 Kb Fragment From The Th Promoter Thamentioning

confidence: 99%

See 1 more Smart Citation

Isolation of an enhancer from the rat tyrosine hydroxylase promoter that supports long-term, neuronal-specific expression from a neurofilament promoter, in a helper virus-free HSV-1 vector system

et al. 2007

Self Cite

View full text Add to dashboard Cite

Direct gene transfer into neurons, using a virus vector, has been used to study neuronal physiology and learning, and has potential for supporting gene therapy treatments for specific neurological diseases. Many of these applications require high-level, long-term recombinant gene expression, in forebrain neurons. We previously showed that addition of upstream sequences from the rat tyrosine hydroxylase (TH) promoter to a neurofilament heavy gene (NF-H) promoter supports long-term expression in forebrain neurons, from helper virus-free Herpes Simplex Virus (HSV-1) vectors. This element in the TH promoter satisfied the definition of an enhancer; it displayed activity at a distance from the basal promoter, and in both orientations. This enhancer supported physiological studies that required long-term expression; a modified neurofilament promoter, containing an insulator upstream of the TH-NFH promoter, supported expression in ∼11,400 striatal neurons at 6 months after gene transfer, and expression for 7, 8, or 14 months, the longest times tested. In contrast, the NF-H promoter alone does not support long-term expression, indicating that the critical sequences are in the 6.3 kb fragment of the TH promoter. In this study, we performed a deletion analysis to identify the critical sequences in the TH promoter that support long-term expression. We localized these critical sequences to an ∼320 bp fragment, and two subfragments of ∼100 bp each. Vectors that contained each of these small fragments supported levels of long-term, neuronal-specific expression that were similar to the levels supported by a vector that contained the initial 6.3 kb fragment of the TH promoter. These small fragments of the TH promoter may benefit construction of vectors for physiological studies, and may support studies on the mechanism by which this enhancer supports long-term expression.

show abstract

Section: Identification Of a 12 Kb Fragment From The Th Promoter Thamentioning

confidence: 95%

Section: Identification Of a 12 Kb Fragment From The Th Promoter Thamentioning

confidence: 99%

Isolation of an enhancer from the rat tyrosine hydroxylase promoter that supports long-term, neuronal-specific expression from a neurofilament promoter, in a helper virus-free HSV-1 vector system

et al. 2007

Self Cite

View full text Add to dashboard Cite

show abstract

“…HSV-1 viruses that contained the chimeric gC-GDNF gene, or the chimeric gC-BDNF gene, or wild-type (wt) gC were derived as described [50] by cotransfecting 2-2 cells with cos6, cos14, cos28, cos48, and each of the three cos56 (containing the gC-GDNF chimeric gene, or the gC-BDNF chimeric gene, or wt gC). Virus stocks were titered by standard plaque assay (Table 1).…”

Section: Immunofluorescent Costaining For Either Gc and Gdnf Or Gc Anmentioning

confidence: 99%

“…pHSVlac stocks were titered by staining with X-gal, and pHSVpkcΔGG stocks were titered using an anti-flag antibody [38]. The titers of vector genomes ((VG)/ml [50]) were determined by extracting DNA from the vector stocks and measuring the amounts of vector DNAs using PCR and primers for the LacZ gene [50] or primers for the pkcΔGG gene (5′ CTACAAAGACGATGACGATAAATCG 3′ (from flag) and 5′ TTCGAGTTTCTCCCAGTCGATATACC 3′ (complementary to nucleotides 1942-1967 of the rat PKCβII cDNA [19,38]). No wt HSV-1 was detected in these vector stocks (<10 plaque forming units (pfu)/ml).…”

Section: Vector Packaging and Titeringmentioning

confidence: 99%

“…pHSVpkcΔGG expresses PkcΔGG, which was detected using an anti-flag antibody (PkcΔGG is a flag-tagged catalytic domain of rat PKC βII that contains a point mutation that abolishes PKC activity [38]). The titers of vector genomes ((VG)/ml [50]) were determined by extracting DNA from the vector stocks and measuring the amounts of vector DNAs using PCR and primers for either the LacZ or pkcΔGG gene. The titers (Table 1) showed that vector stocks prepared using either gC-GDNF or gC-BDNF contained similar titers (IVP/ml or VG/ml) as vector stocks prepared using wt gC.…”

Section: Helper Virus-free Packaging Using Gc-gdnf or Gc-bdnf Or Wt Gcmentioning

confidence: 99%

See 1 more Smart Citation

Targeted gene transfer to nigrostriatal neurons in the rat brain by helper virus-free HSV-1 vector particles that contain either a chimeric HSV-1 glycoprotein C-GDNF or a gC-BDNF protein

Wang¹,

Kong²,

Zhang³

et al. 2005

Molecular Brain Research

Self Cite

View full text Add to dashboard Cite

Direct gene transfer into neurons has potential for both studying neuronal physiology and for developing gene therapy treatments for specific neurological conditions. Due to the heterogeneous cellular composition of the brain, cell-type-specific recombinant gene expression is required for many potential applications of neuronal gene transfer. The two prevalent approaches for achieving celltype-specific expression are to use a cell-type-specific promoter to control recombinant gene expression or to modify a virus vector particle to target gene transfer to a specific cell type. Targeted gene transfer to multiple peripheral cell types has been described, but targeted gene transfer to a specific type of neuron in the brain has yet to be reported. Targeted gene transfer approaches with Herpes Simplex Virus (HSV-1) vectors have focused on modifying glycoprotein C (gC) to remove the heparin binding domain and add a binding activity for a specific protein on the cell surface. This study was designed to develop HSV-1 vectors that target gene transfer to cells that contain receptors for either glial-cell-line-derived neurotrophic factor (GDNF) or brain-derived neurotrophic factor (BDNF), such as nigrostriatal neurons. We isolated chimeric gC-GDNF or chimeric gC-BDNF constructs, and the resulting proteins were incorporated into HSV-1 virus particles. We performed helper virus-free HSV-1 vector packaging in the presence of each chimeric protein. The resulting vector stocks supported 2.2-to 5.0-fold targeted gene transfer to nigrostriatal neurons in the rat brain, compared to vector particles that contained wild-type (wt) gC. Gene transfer to nigrostriatal neurons by vector particles that contained chimeric gC-BDNF was reduced by preincubation with an anti-BDNF antibody. Targeted gene transfer to neurons that contain specific neurotrophic factor receptors may benefit specific physiological and gene therapy studies.

show abstract

Improved HSV‐1 amplicon packaging using virion host shutoff mutants lacking mRNAse activity

Halterman

Giuliano

Bowers

et al. 2006

The Journal of Gene Medicine

View full text Add to dashboard Cite

Given their generous transgene capacity and inherent neurotropism, herpes simplex virus (HSV-1)-based viral vectors are promising tools for gene delivery to the central nervous system. Despite their widespread pre-clinical use, vector toxicity remains a concern with regard to the use of herpes vectors in humans. One potential source of toxicity stems from the tegument-associated virion host shutoff protein (vhs), which induces translational arrest in the host cell through non-specific mRNAse activity. In the current study we utilized a series of HSV-1 viruses containing a deletion in the U(L)41 open reading frame to investigate: (1) the requirement of intact vhs function in amplicon packaging and (2) whether vhs influences the post-transduction survival of dissociated cortical neurons. Our results demonstrate that while amplicon yield was reduced an order of magnitude, U(L)41 deletion was associated with reduced vector toxicity. Furthermore, partial reconstitution of vhs function using mRNAse-inactive point mutants improved amplicon titers without imparting the toxicity observed with wild-type controls. These findings offer a novel approach to improving the titer and toxicity profiles of HSV-based viral vectors.

show abstract

Enhanced reporter gene expression in the rat brain from helper virus-free HSV-1 vectors packaged in the presence of specific mutated HSV-1 proteins that affect the virion

Cited by 33 publications

References 53 publications

Isolation of an enhancer from the rat tyrosine hydroxylase promoter that supports long-term, neuronal-specific expression from a neurofilament promoter, in a helper virus-free HSV-1 vector system

Isolation of an enhancer from the rat tyrosine hydroxylase promoter that supports long-term, neuronal-specific expression from a neurofilament promoter, in a helper virus-free HSV-1 vector system

Targeted gene transfer to nigrostriatal neurons in the rat brain by helper virus-free HSV-1 vector particles that contain either a chimeric HSV-1 glycoprotein C-GDNF or a gC-BDNF protein

Improved HSV‐1 amplicon packaging using virion host shutoff mutants lacking mRNAse activity

Contact Info

Product

Resources

About