Engineering Tissue-Specific Expression of a Recombinant Adenovirus: Selective Transgene Transcription in the Pancreas Using the Amylase Promoter

DeMatteo, Ronald P.; McClane, Steven J.; Fisher, Krishna J.; Yeh, Heidi; Chu, G.; Burke, Charlotte; Raper, Steven E.

doi:10.1006/jsre.1997.5096

Cited by 31 publications

(14 citation statements)

References 13 publications

(6 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…All animal experiments were approved by the animal research committees of the Kyoto University Graduate School of Medicine and the Kobe University Graduate School of Medicine. activation of these promoters has been established (31)(32)(33) and also confirmed by us (see Fig. 6, which is published as supporting information on the PNAS web site).…”

Section: Methodssupporting

confidence: 80%

Lineage tracing and characterization of insulin-secreting cells generated from adult pancreatic acinar cells

Minami

Okuno

Miyawaki

et al. 2005

Proc. Natl. Acad. Sci. U.S.A.

242

211

View full text Add to dashboard Cite

Although several studies have suggested that insulin-secreting cells can be generated in vitro from cells residing in adult exocrine pancreas, neither the origin of these cells nor their precise insulin secretory properties was obtained. We show here that insulinsecreting cells can be derived from adult mouse pancreatic exocrine cells by suspension culture in the presence of EGF and nicotinamide. The frequency of insulin-positive cells was only 0.01% in the initial preparation and increased to Ϸ5% in the culture conditions. Analysis by the Cre͞loxP-based direct cell lineage tracing system indicates that these newly made cells originate from amylase͞ elastase-expressing pancreatic acinar cells. Insulin secretion is stimulated by glucose, sulfonylurea, and carbachol, and potentiation by glucagon-like peptide-1 also occurs. Insulin-containing secretory granules are present in these cells. In addition, we found that the enzymatic dissociation of pancreatic acini itself leads to activation of EGF signaling, and that inhibition of EGF receptor kinase blocks the transdifferentiation. These data demonstrate that pancreatic acinar cells can transdifferentiate into insulin-secreting cells with secretory properties similar to those of native pancreatic ␤ cells, and that activation of EGF signaling is required in such transdifferentiation.

show abstract

Section: Methodssupporting

confidence: 80%

Lineage tracing and characterization of insulin-secreting cells generated from adult pancreatic acinar cells

Minami

Okuno

Miyawaki

et al. 2005

Proc. Natl. Acad. Sci. U.S.A.

242

211

View full text Add to dashboard Cite

show abstract

“…[33][34][35][36][37][38] Non-␤-cells are being considered for the ectopic expression of insulin due to con- cerns about autoimmune destruction of transplanted islets of Langerhans. Type I diabetes results from a genetically susceptible, immune-mediated, selective destruction of more then 90% of insulin-secreting ␤-cells.…”

Section: Discussionmentioning

confidence: 99%

“…Intra-ductal and direct intra-pancreatic injections are efficient ways to deliver adenoviral vector into the mouse pancreas. [33][34][35][36][37][38] Advantages of using adenoviral vector include high level expression, wide tissue tropism, ability to achieve high titers, a short period between transduction and expression (2-4 days), and a large insert capacity. Sophisticated techniques allow subcellular localization of transgene product.…”

Section: Introductionmentioning

confidence: 99%

Adenoviral vector-mediated insulin gene transfer in the mouse pancreas corrects streptozotocin-induced hyperglycemia

Shifrin

Auricchio

et al. 2001

Gene Ther

View full text Add to dashboard Cite

“…The enzyme-digested promoter fragment was ligated into the KpnI and XhoI sites of pGL3 basic vector (Promega). Pancreatic exocrine cell-specific activation of these promoters has been established (17,18) and confirmed by reporter assay in AR42J cells, a rat pancreatic exocrine cell line (data not shown). The FLAG-TR␣1 plasmid (15) was used as the template for cloning human TR␣1 into pENTR-1A Dual Selection (Invitrogen) by using PCR.…”

Section: Methodsmentioning

confidence: 74%

“…The PCR primers were: Amy2-KpnI-5Ј (AAGGTACCGCAGGATGGCCTCAGAAGTAAGAT) and Amy2-3Ј-XhoI (AACTCGAGAGTTGTCAGTGTTCTCTG-TAGCAC) (17). The enzyme-digested promoter fragment was ligated into the KpnI and XhoI sites of pGL3 basic vector (Promega).…”

Section: Methodsmentioning

confidence: 99%

Ligand-bound Thyroid Hormone Receptor Contributes to Reprogramming of Pancreatic Acinar Cells into Insulin-producing Cells

Furuya¹,

Shimura

Asami³

et al. 2013

Journal of Biological Chemistry

View full text Add to dashboard Cite

Background: One goal of diabetic regenerative medicine is to convert mature pancreatic acinar cells into insulin-producing cells. Results: Ligand-bound thyroid hormone receptor ␣ (TR␣), which interacts with p85␣, induces phosphatidylinositol 3-kinase (PI3K) signaling and insulin expression. Conclusion: PI3K signaling must be activated for TR␣-induced reprogramming of pancreatic acinar cells. Significance: TR␣ is critical for postnatal expansion of the ␤-cell mass.

show abstract

Engineering Tissue-Specific Expression of a Recombinant Adenovirus: Selective Transgene Transcription in the Pancreas Using the Amylase Promoter

Cited by 31 publications

References 13 publications

Lineage tracing and characterization of insulin-secreting cells generated from adult pancreatic acinar cells

Lineage tracing and characterization of insulin-secreting cells generated from adult pancreatic acinar cells

Adenoviral vector-mediated insulin gene transfer in the mouse pancreas corrects streptozotocin-induced hyperglycemia

Ligand-bound Thyroid Hormone Receptor Contributes to Reprogramming of Pancreatic Acinar Cells into Insulin-producing Cells

Contact Info

Product

Resources

About