Engineering streptococcal protein G for increased alkaline stability

Abstract

Most protein-based affinity chromatography media are very sensitive towards alkaline treatment, which is a preferred method for regeneration and removal of contaminants from the purification devices in industrial applications. In a previous study, we concluded that a simple and straightforward strategy consisting of replacing asparagine residues could improve the stability towards alkaline conditions. In this study, we have shown the potential of this rationale by stabilizing an IgG-binding domain of streptococcal protein G, i.e. the C2 domain. In order to analyze the contribution of the different amino acids to the alkaline sensitivity of the domain we used a single point mutation strategy. Amino acids known to be susceptible towards high pH, asparagine and glutamine, were substituted for less-alkali-susceptible residues. In addition, aspartic acid residues were mutated to evaluate if the stability could be further increased. The stability of the different C2 variants was subsequently analyzed by exposing them to NaOH. The obtained results reveal that the most sensitive amino acid towards alkaline conditions in the structure of C2 is Asn36. The double mutant, C2(N7,36A), was found to be the most stable mutant constructed. In addition to the increased alkaline stability and also very important for potential use as an affinity ligand, this mutated variant also retains the secondary structure, as well as the affinity to the Fc fragment of IgG.

Tumor cell targeted gene delivery by adenovirus 5 vectors carrying knobless fibers with antibody-binding domains

“…13 The Z wt domain was derived from the B domain of SpA. Plasmid pAC2dimer, encoding a head-to-tail dimer of the WT C2 domain of Streptococcal protein G, 48 was used as the template for PCR amplification of the C2 encoding gene fragment, using primers introducing an upstream ClaI site and a downstream stop codon followed by an XhoI site (upstream primer sequence, 5 0 -3 0 : GGGCCATCGATCA CTTACAAACTTGTTATTAAT; downstream primer sequence, 5 0 -3 0 : GGGCTCGAGTTATTCAGTAACTGTAAA GGTCTT). Recombinant Ad fiber R7-C2-C2 (Figure 1c) Antibody-binding Ad for targeted gene delivery P Henning et al was constructed by genetically replacing the Z wt -Z wt motif in R7-Z wt -Z wt with the dimeric C2 IgG-binding motif, using the ClaI and XhoI restriction sites.…”

Purification Systems Based on Bacterial Surface Proteins

“…Furthermore, the interactions between SPG and Fc involve many charged and polar residues, forming hydrogen bonds and salt bridges while the binding between SPA and Fc involve mostly hydrophobic interactions (Sauer-Eriksson et al 1995). The strength of the binding to Fc has been determined using SPR to around 20-100 nM for the C2-domain and low nanomolar values for the whole SPG molecule have been reported (Akerstrom & Bjorck 1986;Gulich et al 2002;Sagawa et al 2005). The binding of SPA and SPG to Fc is pH-dependent.…”

“…The alkali stabilized albumin-binding domain provides a robust affinity ligand for purification or depletion of albumin from for example serum to facilitate detection of low abundant biomarkers (Eriksson et al 2010;Linhult et al 2003). Furthermore, the strategy for increasing tolerance to alkali has proven effective also when applied to the Z-domain (Linhult et al 2004) and the C2-domain (Gulich et al 2002). The strategies employed to those domains evaluated, apart from asparagine residues, also replacements of glutamine residues, and showed that all replacements have to be evaluated on a case-by-case basis.…”

Inhibition of the Reactivity of Coombs Sera with Igg-Sensitized Human Erythrocytes by Streptococcal Protein-G (Spg)

“…SpG binds the Fc regions of IgG from many mammalian species [1]. Sloan and collaborators reported that the primary amino acid sequence of the IgG-binding domains (C1, C2, and C3) of SpG are not homologous to those of the corresponding areas (E, D, A, B and C) of Staphylococcal protein-A (SpA) [2].…”