Engineering E. coli for the biosynthesis of 3-hydroxy-γ-butyrolactone (3HBL) and 3,4-dihydroxybutyric acid (3,4-DHBA) as value-added chemicals from glucose as a sole carbon source

Dhamankar, Himanshu; Tarasova, Yekaterina; Martin, Collin H.; Prather, Kristala L. J.

doi:10.1016/j.ymben.2014.06.004

Cited by 36 publications

(30 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The transcription start site is denoted in red and the RBS in green. To construct pHH-cg44-GFP, the hybrid promoter cg44 and gfp were inserted into a modified form of the plasmid pHHD01K (26,27), which includes the rrnB terminator (ccaggcatcaaataaaacgaaaggctc agtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc) downstream of the gene encoding tetR. Briefly, gfp was amplified from pSB1A2-GFP (17) with primers pHH-GFP-R and cg44-RBS-GFP-F1.…”

Section: Methodsmentioning

confidence: 99%

Layered dynamic regulation for improving metabolic pathway productivity in Escherichia coli

Doong

Gupta

Prather

2018

Proc. Natl. Acad. Sci. U.S.A.

174

148

View full text Add to dashboard Cite

Microbial production of value-added chemicals from biomass is a sustainable alternative to chemical synthesis. To improve product titer, yield, and selectivity, the pathways engineered into microbes must be optimized. One strategy for optimization is dynamic pathway regulation, which modulates expression of pathway-relevant enzymes over the course of fermentation. Metabolic engineers have used dynamic regulation to redirect endogenous flux toward product formation, balance the production and consumption rates of key intermediates, and suppress production of toxic intermediates until later in the fermentation. Most cases, however, have utilized a single strategy for dynamically regulating pathway fluxes. Here we layer two orthogonal, autonomous, and tunable dynamic regulation strategies to independently modulate expression of two different enzymes to improve production of D-glucaric acid from a heterologous pathway. The first strategy uses a previously described pathway-independent quorum sensing system to dynamically knock down glycolytic flux and redirect carbon into production of glucaric acid, thereby switching cells from "growth" to "production" mode. The second strategy, developed in this work, uses a biosensor for -inositol (MI), an intermediate in the glucaric acid production pathway, to induce expression of a downstream enzyme upon sufficient buildup of MI. The latter, pathway-dependent strategy leads to a 2.5-fold increase in titer when used in isolation and a fourfold increase when added to a strain employing the former, pathway-independent regulatory system. The dual-regulation strain produces nearly 2 g/L glucaric acid, representing the highest glucaric acid titer reported to date in K-12 strains.

show abstract

Section: Methodsmentioning

confidence: 99%

Layered dynamic regulation for improving metabolic pathway productivity in Escherichia coli

Doong

Gupta

Prather

2018

Proc. Natl. Acad. Sci. U.S.A.

174

148

View full text Add to dashboard Cite

show abstract

“…Department of Energy (Gupta et al 2016 ). The recombinant E. coli strain was developed for the biosynthesis of 3-hydroxy-γ-butyrolactone and 3,4-dihydroxybutyricacid, which is a precursor in the synthesis of a variety of pharmaceuticals, solvents and polymers (Dhamankar et al 2014 ).…”

Section: Methodsmentioning

confidence: 99%

“…The LAB culture was grown on MRS (de Mann Rogosa Sharpe) medium and the yeast was grown on YPD (Yeast extract, Peptone, Dextrose) medium. The E. coli were grown on LB (Lysogeny broth) medium as described by Dhamankar et al ( 2014 ). The MRS medium composition was 1% peptone, 0.8% egg extract, 0.4% yeast extract, 2% d -glucose, 0.5% sodium acetate trihydrate, 0.1% polysorbate 80 (Tween 80), 0.2% dipotassium hydrogen phosphate, 0.2% triammonium citrate, 0.02% magnesium sulfate heptahydrate, and 0.005% manganese sulfate tetrahydrate.…”

Section: Methodsmentioning

confidence: 99%

Natural antibacterial agents from arid-region pretreated lignocellulosic biomasses and extracts for the control of lactic acid bacteria in yeast fermentation

et al. 2018

View full text Add to dashboard Cite

Bacterial contamination is one of the major challenges faced by yeast fermentation industries as the contaminating microorganisms produce lactic acid and acetic acid, which reduces the viability of yeast, and hence fermentation yields. The primary bacterial contaminants of yeast fermentations are lactic acid bacteria (LAB). This study aims to identify potential natural antibacterial fractions from raw and pretreated lignocellulosic biomasses found in Abu Dhabi, UAE, in terms of LAB inhibition capacity, allowing growth of the yeast. The analysis was carried out using plating technique. Pretreatment liquid of the mangrove stem Avicennia marina hydrothermally pretreated at 210 °C exhibited the widest inhibition zone with an average diameter of 14.5 mm, followed by the pretreatment liquid of mangrove leaf pretreated at 190 °C, Salicornia bigelovii pretreated at 202 °C and rachis of date palm Phoenix dactylifera pretreated at 200 °C. The compounds responsible for the antibacterial activity will be characterized in further study.

show abstract

“…Food industry, Sweetener aspartame [12] 3-hydroxy-γ-butyrolactone synthesis of a variety of pharmaceuticals, polymers and solvents [45] Violacein and deoxyviolacein Therapeutic against pathogenic bacteria and viruses as well as tumor cells [127] 1,2,4-butanetriol Production of 1,2,4-butanetriol trinitrate (military propellant) [149] Taurine Amino acid for clinical treatment such as cardiovascular diseases, hepatic disorders, alcoholism and cystic fibrosis [33] Silk Proteins Materials and textile applications [53] diphosphomevalonate decarboxylase (EC 4.1.1.33) created the possibility of a new method for producing isobutylene (Fig. 7).…”

Section: Compoundmentioning

confidence: 99%

Engineering biological systems toward a sustainable bioeconomy

Lopes

2015

Journal of Industrial Microbiology and Biotechnology

View full text Add to dashboard Cite

The nature of our major global risks calls for sustainable innovations to decouple economic growth from greenhouse gases emission. The development of sustainable technologies has been negatively impacted by several factors including sugar production costs, production scale, economic crises, hydraulic fracking development and the market inability to capture externality costs. However, advances in engineering of biological systems allow bridging the gap between exponential growth of knowledge about biology and the creation of sustainable value chains for a broad range of economic sectors. Additionally, industrial symbiosis of different biobased technologies can increase competitiveness and sustainability, leading to the development of eco-industrial parks. Reliable policies for carbon pricing and revenue reinvestments in disruptive technologies and in the deployment of eco-industrial parks could boost the welfare while addressing our major global risks toward the transition from a fossil to a biobased economy.

show abstract

Engineering E. coli for the biosynthesis of 3-hydroxy-γ-butyrolactone (3HBL) and 3,4-dihydroxybutyric acid (3,4-DHBA) as value-added chemicals from glucose as a sole carbon source

Cited by 36 publications

References 26 publications

Layered dynamic regulation for improving metabolic pathway productivity in Escherichia coli

Layered dynamic regulation for improving metabolic pathway productivity in Escherichia coli

Natural antibacterial agents from arid-region pretreated lignocellulosic biomasses and extracts for the control of lactic acid bacteria in yeast fermentation

Engineering biological systems toward a sustainable bioeconomy

Contact Info

Product

Resources

About