Engineering Cellular Biosensors with Customizable Antiviral Responses Targeting Hepatitis B Virus

Abstract

SynNotch receptor technology is a versatile tool that uses the regulatory notch core portion with an extracellular scFv and an intracellular transcription factor that enables to program customized input and output functions in mammalian cells. In this study, we designed a novel synNotch receptor comprising scFv against HBs antigen linked with an intracellular artificial transcription factor and exploited it for viral sensing and cellular immunotherapy. The synNotch receptor expressing cells sensed HBV particles and membrane-bound HBs antigens and responded by expressing reporter molecules, secNL or GFP. We also programmed these cells to dispense antiviral responses such as type I interferon and anti-HBV neutralizing mouse-human chimeric antibodies. Our data reveal that synNotch receptor signaling works for membrane-bound ligands such as enveloped viral particles and proteins borne on liposomal vesicles. This study establishes the concepts of ''engineered immunity'' where the synNotch platform is utilized for cellular immunotherapy against viral infections.

Sentinel cells enable genetic detection of SARS-CoV-2 Spike protein

“…Antigen recognition induces the cleavage of a TF, which translocates into the nucleus to activate output expression ( Figure 1A ). Notably, Syn-Notch has previously been used to successfully detect the hepatitis B virus (HBV) 29 , thus we were optimistic that it could be adapted for use as an extracellular sensor to detect the SARS-CoV-2 Spike protein and generate a customizable transcriptional output upon this detection.…”

“…However, this may change in the future, as ongoing work generating allogeneic cell therapies shows significant promise 54 . We hope that this work, along with the prior art with HBV 29 and HIV 55 , may lead to successful antiviral cell-based therapies in order to combat future threats, much as work on mRNA vaccines starting in the 1990s is proving useful to us today. In the meantime, these systems could be adapted for other use cases.…”

“…We first speculated that the endogenous binder of Spike, ACE2, might be usable as an antigen sensor. The ACE2-Spike interaction is estimated to have a K D ranging between 1.2 and 22nM 24,26,40,41 , whereas the scFv used to target the original SynNotch to CD19 has a K D of 0.3nM 42 and the scFv successfully used to adapt Syn-Notch to target HBV has a K D of~0.35nM 29 . However, we suspect this affinity difference is not the main reason ACE2-Notch didn't yield a detectable signal output in the presence of Spike, given that an scFv against the human protein Her2 with K D of 210nM has been recently described to enable Syn-Notch activation 43 .…”

Biomaterial-based immunoengineering to fight COVID-19 and infectious diseases

“…Through the genetic engineering process, these cells can mimic, to some extent, the immune cell responses required to suppress infections. 124 Immunomodulation for the healing and regeneration of tissues and organs In the previous sections, we discussed the prevention of SARS-CoV-2 viral infection with vaccine supplements and the approaches to enhance viral clearance and mediate inflammatory-related symptoms at a systemic and tissue-specific level with immunotherapies. However, the long-term pathological effects of SARS-CoV-2 infection and the potential to exacerbate or induce future complications, even in mild cases, are just beginning to be explored.…”

Table_1.XLS

“…Reverse transcription was performed using ReverTra Ace qPCR-RT kit (TOYOBO). PCR reagents were purchased from Takara and the primers for IFNβ1 and ISG15 were obtained from Eurofins with the following sequences; IFNβ1 Fwd: GTCAGAGTGGAAATCCTAAG and IFNβ1 Rev: ACAGCATCTGCTGGTTGAAG (Hu et al, 2010) and ISG15 Fwd: CTCTGAGCATCCTGGTGAGGAA and ISG15 Rev: AAGGTCAGCCAGAACAGGTCGT (Matsunaga et al, 2020). The expression of genes was quantified using CFX96 TM Real-time system (Bio-Rad) and normalized against the expression of β-actin in the corresponding cells.…”