Endothelial tetraspanin microdomains regulate leukocyte firm adhesion during extravasation

Abstract

IntroductionPlasma membrane contains small organized microdomains (lipid rafts) in which restricted repertoires of proteins are arranged together. 1,2 In resting cells, lipid rafts are estimated to be around 100 nm in diameter, including a few dozen proteins, and are distributed randomly on the cell surface, covering up to 50% of the plasma membrane. Upon cell activation, raft domains coalesce, recruiting and excluding different receptors, and allowing the proper organization of signaling complexes for efficient signal transduction. 1,2 Tetraspanins comprise a large number of small palmitoylated polypeptides that span the plasma membrane 4 times, [3][4][5][6] and form microdomains that contain a restricted repertoire of proteins. Biochemically, they share some properties with lipid rafts, but tetraspanin microdomains are based on protein-protein interactions. [7][8][9][10] Tetraspanins have a highly conserved structure with a short and a large extracellular loop (LEL) where 2 or 3 disulfide bonds can be formed. 11 This large loop interacts noncovalently with other tetraspanins and transmembrane proteins, including integrins and adhesion receptors of the immunoglobulin (Ig) superfamily. Although all mammalian cells express different tetraspanins, genetic approaches have been elusive and their function has not yet been fully elucidated. However, their role in antigen presentation and sperm-egg binding has been recently underscored. [12][13][14][15][16][17][18][19][20] The association of certain plasma membrane proteins to the cortical actin cytoskeleton is critical for their proper localization and function. Thus, the concentration of selectins and their ligands on the tip of microvilli 21,22 both at the leukocyte and the apical surface of endothelial cells favors their interaction during the rolling phase of leukocyte extravasation. Likewise, vascular cell adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1), which are relevant in the subsequent leukocyte firm adhesion step, are also displayed anchored to actin through ezrin-radixin-moesin proteins (ERMs) 23,24 at the apical surface on endothelial cells. Upon leukocyte firm adhesion, the engagement of VCAM-1 and ICAM-1 triggers the reorganization of the endothelial cortical actin cytoskeleton, building up a 3-dimensional docking structure that prevents the detachment of leukocytes by shear stress. 22,23 Here, we show that ICAM-1 and VCAM-1 are included in tetraspanin microdomains that regulate their membrane expression and the efficient adhesive function necessary for proper leukocyte transendothelial migration under flow conditions. Materials and methods Cells and cell culturesHuman umbilical vein endothelial cells (HUVECs) were obtained and cultured as previously described. 25 Cells were used up to the third passage in all assays. To activate HUVECs, tumor necrosis factor-␣ (TNF-␣; 20 ng/mL)(R&D Systems, Minneapolis, MN) was added to the culture media 20 hours before the assays were performed. T lymphoblasts were derived The online vers...

Leukocyte transendothelial migration: A local affair

“…50,[72][73][74][75] These platforms are controlled by tetraspannins, transmembrane proteins that keep the platforms together and organize it into small microdomains. 75,76 It has been shown that assembly of F-actin, the major component and driving force to induce such apical protrusions, requires the activation small GTPases RhoG and Rac1. 67,77 Currently, the major function of the docking structure is thought to provide guidance for transmigrating leukocytes.…”

Tetraspanins CD9 and CD81 Modulate HIV-1-Induced Membrane Fusion

“…The fusion inhibitor peptide T20 was from Roche Diagnostics. Recombinant human IL The wild type-CD9-GFP and wild type-CD81-GFP constructs have been described previously (16,33). These expression vectors were transfected in CEM and HeLa P5 cells by electroporation or nucleofection, following the manufacturer's instructions.…”

“…To knockdown the expression of specific tetraspanins, the RNA duplexes targeting the silencing sequences CAATTTGTGTCCCTCGGGC and CACCTTCTATGTAGGCATC (Ambion) for CD81 and ACCTTCAC CGTGAAGTCCT and GAGCATCTTCGAGCAAGAAA for CD9 (16) were used. A double-stranded siRNA designed by Eurogentec, which does not pair with any eucaryotic mRNA, was used as control.…”

“…The LEL domain contains critical protein-protein interaction sites that allow noncovalent association of these proteins with other tetraspanins and transmembrane proteins, such as integrins and members of the Ig superfamily (13,14). In this regard, it has been demonstrated that tetraspanins can modulate the function of proteins associated with them such as integrins (15) or ICAM-1 and VCAM-1 (16). Disruption of tetraspanin-based membrane microdomains interferes with important cellular processes, such as signal transduction, Ag presentation, cell migration, and cellular adhesion (14,(17)(18)(19).…”

The Tetraspanin CD9 Localizes to Platelet-Platelet Contacts and Regulates Thrombus Stability

“…It is also expressed on macrophages (Wang 2002), eosinophils (Fernvik 1995), basophils (Fureder 1994), marginal zone B cells (Won 2002), endothelial cells (Barreiro 2005, Klein-Soyer 2000, ectodermal nervous tissue (Banerjee 1997), smooth muscle cells (Scherberich 1998, Scherberich 2002, and oocytes .…”