Endophytic Bacillus spp. produce antifungal lipopeptides and induce host defence gene expression in maize

Gond, Surendra K.; Bergen, Marshall S.; Torres, Mónica S.; White, James F.

doi:10.1016/j.micres.2014.11.004

Cited by 301 publications

(152 citation statements)

References 32 publications

Supporting

Mentioning

137

Contrasting

Unclassified

Order By: Relevance

“…Bacillus spp. protect plants through ISR and successfully control the disease severity in many plants, such as tobacco, maize, melon and Arabidopsis (Choudhary and Johri 2009;García-Gutiérrez et al 2013;Gond et al 2015;Huang et al 2015;Kim et al 2015). Therefore, it is possible that the BCA isolated in the present study might act as an ISR inducer.…”

Section: Discussionmentioning

confidence: 83%

Isolation and characterization of Bacillus altitudinis JSCX-1 as a new potential biocontrol agent against Phytophthora sojae in soybean [Glycine max (L.) Merr.]

Zhou

Chen

et al. 2017

Plant Soil

View full text Add to dashboard Cite

Aims Phytophthora root and stem rot caused by the oomycete plant pathogen Phytophthora sojae (Kaufmann & Gerdemann), is a destructive disease of soybean [Glycine max (L.) Merr.]. There is no straightforward available method to control this disease. The present study aimed to isolate a biocontrol agent (BCA) to control Phytophthora rot and gain insights into the mechanisms of biocontrol activity. Methods Antagonistic bacteria screening, inoculation assays, histochemical and fluorometric staining and real-time polymerase chain reaction (RT-PCR) were used to achieve the goals of the present study.Results The results indicated that the isolated BCA strain JSCX-1 was characterized as Bacillus altitudinis. Further studies showed that JSCX-1 bacterial filtrate inhibited the mycelial growth and zoospore germination of P. sojae. Greenhouse experiments showed that biocontrol efficiency of JSCX-1 against P. sojae was 49.28 ± 3.42%. Our results revealed that JSCX-1 increased the reactive oxygen species (ROS) production and callose deposition of soybean leaves. Moreover, JSCX-1 upregulated the transcriptional level of the G. max PR1a gene but not that of the LOX and ERF genes. Conclusions B. altitudinis JSCX-1 can effectively reduce the infectivity of P. sojae via increasing the ROS production and callose deposition on soybean, and up-regulating the expression of salicylate-responsive gene GmPR1a.

show abstract

Section: Discussionmentioning

confidence: 83%

Isolation and characterization of Bacillus altitudinis JSCX-1 as a new potential biocontrol agent against Phytophthora sojae in soybean [Glycine max (L.) Merr.]

Zhou

Chen

et al. 2017

Plant Soil

View full text Add to dashboard Cite

show abstract

“…Novel secondary metabolites like lipopeptides, Oxylipins, Limnazine, beta-1,3-1, 4-glucanase are reported from bacillus Sps. (Gond et al, 2015, Trapp et al, 2015, Chen et al, 2013, Asolkar et al, 2002, Zouari et al, 2015, Jin et al, 2011, Liu et al, 2009. Enterobacter cloacae.…”

Section: Discussionmentioning

confidence: 99%

In vitro and in vivo antimicrobial activity of Ulva lactuca Linn. (Green algae) associated endophytic bacterial Strains

Habbu¹,

Warad²,

Shastri³

et al. 2016

J App Pharm Sci

View full text Add to dashboard Cite

The development of resistance by pathogenic microorganisms to synthetic antibiotics encouraged researchers to find novel drugs for the treatment of infectious diseases. This opened new avenues to investigate the antimicrobial efficacy of active extracts/constituents from plant endophytes. In the present study, we have isolated endophytic bacteria (ULB-I, II and III) from green algae Ulva lactuca Linn. and the same bacteria were used for fermentation and extraction. Chloroform and ethyl acetate fractions of ULB-I, II and III were prepared and screened for in-vitro antimicrobial activities and also against Kleibesella pnumoniae infected mice in-vivo. In-vitro anti-microbial activities of ULB-I, II and III were performed against pathogenic bacteria, fungi and Mycobacterium tuberculosis H37 RV strain. From the phylogenetic analysis, the isolated endophytic organisms were identified as Bacillus subtilis JCM strain (ULB-I) and Enterobacter cloacae NBRC strain (ULB-II and III). ULB-I was found to be active against Staphylococcus aureus (1.6µg/ml) and Enterococcus feacalis (0.2µg/ml). The MIC against Staphylococcus aureus and Kleibesella pnumoniae was found to be 0.4µg/ml for ULB-II. A significant anti-fungal activity was observed against Aspergillus flavus (0.2-3.2µg/ml) and Aspergillus niger (0.2-0.4µg/ml). Further, Chloroform fraction of ULB-II and ethyl acetate fraction of ULB-III have shown significant anti-tubercular activity against the tested organism with MIC of 6.25µg/ml. This was supported by in-vivo antimicrobial activity against K. pneumoniae infection in mice and least hemolytic activity against erythrocytes was observed. HPTLC analysis of above fractions further confirmed the presence of polyvalent secondary metabolites.

show abstract

“…The genomic DNA of isolate YSPMK11 was subjected for the identification of two lipopeptide genes, i.e., surfactin (srfC) and iturin A (ituD), as described earlier by Gond et al (2015). The primer sequences used were: ItuD1F (GATGCGATCTCCTTGGATGT), ItuD1R (ATCGTCA TGTGCTGCTTGAG), Sur3F (ACAGTATGGAGGCAT GGTC), and Sur3R (TTCCGCCACTTTTTCAGTTT).…”

Section: Amplification Of Lipopeptide Genesmentioning

confidence: 99%

Bacillus pumilus strain YSPMK11 as plant growth promoter and bicontrol agent against Sclerotinia sclerotiorum

2017

View full text Add to dashboard Cite

A study was executed in a direction to attenuate Sclerotinia stalk rot (SSR) disease through biocontrol agent and also to enhance crop productivity. Culture filtrate of bacterial strain YSPMK11 inhibited growth of Sclerotinia sclerotiorum in vitro which also exhibited higher plant growth promoting attributes. Interaction studies revealed maximum (81.50%) growth inhibition at 35°C and pH 7.0 after 72 h incubation period with 15% culture filtrate. Based upon 16S rRNA gene sequence strain, YSPMK11 was identified as Bacillus pumilus. Furthermore, the genome of this isolate was searched for antimicrobial lipopeptide, i.e., ItuD and SrfC genes. The PCR amplification results showed the presence of both these lipopeptide genes in isolate YSPMK11. Iturin A as antifungal compound was identified as major components of fraction through GC/MS. In field experiments, the application of strain YSPMK11 cell suspension (10 8 CFU/ml) suppressed disease severity by 93% and increased curd yield by 36% which was more that of commercially used fungicide in farmer practices under mid-hills of Himachal Pradesh.Conclusively, our study is first to demonstrate the effect of B. pumilus strain YSPMK11 in suppression of SSR under field conditions and would be employed as an efficient biocontrol agent to replace commercial fungicides in cauliflower cropping system. In addition, the presence of both lipopeptide genes (ItuD and SrfC) and iturin A in this isolate makes him potent strain for biological control application in agriculture.

show abstract

Endophytic Bacillus spp. produce antifungal lipopeptides and induce host defence gene expression in maize

Cited by 301 publications

References 32 publications

Isolation and characterization of Bacillus altitudinis JSCX-1 as a new potential biocontrol agent against Phytophthora sojae in soybean [Glycine max (L.) Merr.]

Isolation and characterization of Bacillus altitudinis JSCX-1 as a new potential biocontrol agent against Phytophthora sojae in soybean [Glycine max (L.) Merr.]

In vitro and in vivo antimicrobial activity of Ulva lactuca Linn. (Green algae) associated endophytic bacterial Strains

Bacillus pumilus strain YSPMK11 as plant growth promoter and bicontrol agent against Sclerotinia sclerotiorum

Contact Info

Product

Resources

About