Endogenous U6 promoters improve CRISPR/Cas9 editing efficiencies in Sorghum bicolor and show potential for applications in other cereals

Massel, Karen; Lam, Yasmine; Hintzsche, Jessica; Lester, Nicholas; Botella, José Ramón; Godwin, Ian D.

doi:10.1007/s00299-021-02816-z

Cited by 22 publications

(11 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The maize ubiquitin (ZmUbi-1 or Ubi-1) gene was used to drive the Cas9 and the NPTII gene expression. Two different sorghum U6 promoters that have been developed were chosen to drive the expression of the gRNAs 11 In our study, 97% of albinos (33 in 34) were edited by both CRISPR guides, which indicates the designed gRNAs by the online software CRISPOR showed high e ciency. Additionally, the endogenous U6 promoters from sorghum were both effective in expressing the gRNAs which is in correspondence with other studies demonstrating the effectiveness of endogenous U6 promoters in their respective grains 12,13 .…”

Section: Discussionmentioning

confidence: 92%

Targeting PDS gene to establish a transgene-free genome editing system in sorghum

Zhang,

Cheng,

Massel

et al. 2024

Preprint

Self Cite

View full text Add to dashboard Cite

Genome editing in plants using CRISPR/Cas9 typically involves integrating transgenic constructs into plant genome. However, a challenge arises after the target gene is successfully edited, transgene elements such as Cas9, gRNA cassette, and selective marker genes remain integrated. This integration of transgenes causes regulatory and environmental concerns, particularly for commercialization. In addressing this issue, we present the establishment of a transgene-free genome editing system in sorghum, achieved through transient gene expression without selection. We selected the phytoene desaturase (PDS) gene as the target due to its capacity to induce a visible phenotypic change, namely albinism, upon mutation. Following microprojectile co-transformation with maize optimised Cas9 vector and a gRNA cassette with kanamycin resistance gene, immature embryo (IE) derived tissues were divided into two groups (selection and non-selection) and deployed as parallel experiments. Remarkably, 4 out of 18 homozygous/biallelic editing lines in the non-selection group were identified as transgene-free lines in the T0 generation, with no traceable transgenes. Conversely, no transgene-free editing line was achieved in the selection group. This strategy not only enables to regenerate transgene-free genome-edited lines more efficiently but also saves one generation of time by eliminating the need for self-crossing or out-crossing. Our results displayed the feasibility of achieving transgene-free genome-edited plants within a single generation in sorghum. Furthermore, this approach opens avenues for vegetatively propagated crops like pineapple, sugarcane, and banana to obtain transgene-free genome-edited lines, facilitating their commercialization.

show abstract

Section: Discussionmentioning

confidence: 92%

Targeting PDS gene to establish a transgene-free genome editing system in sorghum

Zhang,

Cheng,

Massel

et al. 2024

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…In 2021, An et al used the mannan synthase (MAS) promoter to drive Cas9, further increasing the mutation rate at the edit site by up to 75% [ 161 ]. In 2021, Massel et al used the endogenous U6 promoter (SbU62.3) to improve CRISPR/Cas9 editing efficiency in sorghum ( Sorghum ‘Bicolor’ (L.) Moench) [ 162 ]. In 2022, Liu et al developed an efficient Arabidopsis γ-glutamylcysteine synthase promoter, called AtGCSpro, with an average homozygous/double mutation frequency 1.7-fold and 8.3-fold higher than the p2 × 35Spro-Cas9 system for single and two target sites in the genome, respectively [ 163 ].…”

Section: Strategies and Methods For Optimizing Crispr/cas9 Gene-editi...mentioning

confidence: 99%

Strategies and Methods for Improving the Efficiency of CRISPR/Cas9 Gene Editing in Plant Molecular Breeding

Zhou

Luan

Liu

et al. 2023

Plants

View full text Add to dashboard Cite

Following recent developments and refinement, CRISPR-Cas9 gene-editing technology has become increasingly mature and is being widely used for crop improvement. The application of CRISPR/Cas9 enables the generation of transgene-free genome-edited plants in a short period and has the advantages of simplicity, high efficiency, high specificity, and low production costs, which greatly facilitate the study of gene functions. In plant molecular breeding, the gene-editing efficiency of the CRISPR-Cas9 system has proven to be a key step in influencing the effectiveness of molecular breeding, with improvements in gene-editing efficiency recently becoming a focus of reported scientific research. This review details strategies and methods for improving the efficiency of CRISPR/Cas9 gene editing in plant molecular breeding, including Cas9 variant enzyme engineering, the effect of multiple promoter driven Cas9, and gRNA efficient optimization and expression strategies. It also briefly introduces the optimization strategies of the CRISPR/Cas12a system and the application of BE and PE precision editing. These strategies are beneficial for the further development and optimization of gene editing systems in the field of plant molecular breeding.

show abstract

“…The CRISPR-SbSOMT construct was chemically synthesized (Gene Universal, USA). In brief, two gRNAs, including gRNA1: GTTGAACACGGTGTTCCACG and gRNA2: GCACCGGACTACGCTGTGCG, were designed using CHOPCHOP v3 70 , individually introduced to the downstream of SbU6 promoters, SbU62.3 and SbU63.1 , respectively, and were further cloned into the plasmid that harbors a selective marker ( NPTII ) to generate CRISPR-SbSOMT construct 50 . The CRISPR/Cas9 plasmid, pBUN411, was modified for sorghum particle bombardment 71 .…”

Section: Methodsmentioning

confidence: 99%

Regioselective stilbene O-methylations in Saccharinae grasses

Lui,

Pow,

Lin

et al. 2023

Nat Commun

Self Cite

View full text Add to dashboard Cite

O-Methylated stilbenes are prominent nutraceuticals but rarely produced by crops. Here, the inherent ability of two Saccharinae grasses to produce regioselectively O-methylated stilbenes is reported. A stilbene O-methyltransferase, SbSOMT, is first shown to be indispensable for pathogen-inducible pterostilbene (3,5-bis-O-methylated) biosynthesis in sorghum (Sorghum bicolor). Phylogenetic analysis indicates the recruitment of genus-specific SOMTs from canonical caffeic acid O-methyltransferases (COMTs) after the divergence of Sorghum spp. from Saccharum spp. In recombinant enzyme assays, SbSOMT and COMTs regioselectively catalyze O-methylation of stilbene A-ring and B-ring respectively. Subsequently, SOMT-stilbene crystal structures are presented. Whilst SbSOMT shows global structural resemblance to SbCOMT, molecular characterizations illustrate two hydrophobic residues (Ile144/Phe337) crucial for substrate binding orientation leading to 3,5-bis-O-methylations in the A-ring. In contrast, the equivalent residues (Asn128/Asn323) in SbCOMT facilitate an opposite orientation that favors 3ʹ-O-methylation in the B-ring. Consistently, a highly-conserved COMT is likely involved in isorhapontigenin (3ʹ-O-methylated) formation in wounded wild sugarcane (Saccharum spontaneum). Altogether, our work reveals the potential of Saccharinae grasses as a source of O-methylated stilbenes, and rationalize the regioselectivity of SOMT activities for bioengineering of O-methylated stilbenes.

show abstract

Endogenous U6 promoters improve CRISPR/Cas9 editing efficiencies in Sorghum bicolor and show potential for applications in other cereals

Cited by 22 publications

References 9 publications

Targeting PDS gene to establish a transgene-free genome editing system in sorghum

Targeting PDS gene to establish a transgene-free genome editing system in sorghum

Strategies and Methods for Improving the Efficiency of CRISPR/Cas9 Gene Editing in Plant Molecular Breeding

Regioselective stilbene O-methylations in Saccharinae grasses

Contact Info

Product

Resources

About