Elucidation of the Structural Determinants Responsible for the Specific Formation of Heterodimeric Mxd1/Max b-HLH-LZ and Its Binding to E-Box Sequences

Montagne, Martin; Naud, Jean-François; Lavigne, Pierre

doi:10.1016/j.jmb.2007.11.062

Cited by 10 publications

(14 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As expected, the addition of the E‐box probe significantly increased the helical content of c‐Myc'RL (Figure a). Indeed, as reported elsewhere for other b‐HLH‐LZ (as well as for b‐LZ (Chan et al ., ) and b‐HLH (Cave et al ., ; Ferré‐D'amaré et al ., ; Fieber et al ., ; Montagne et al ., ; Naud et al ., ; Naud et al ., ; Rishi and Vinson, ; Wendt et al ., )), this increase comes from the stabilization of the b‐region into an α‐helix upon interaction with DNA (Cave et al ., ; Ferré‐D'amaré et al ., ; Fieber et al ., ; Montagne et al ., ; Naud et al ., ; Naud et al ., ; Rishi and Vinson, ; Wendt et al ., ). The [Θ] 222 nm of c‐Myc'RL at 20 °C in the presence of E‐box DNA is −7500 deg·cm 2 ·dmol –1 , which corresponds to ~21% of the maximal helix content expected for a peptide of this length (i.e., –36 000 deg·cm 2 ·dmol –1 as calculated from the classical formalism developed by Chen et al, ).…”

Section: Resultsmentioning

confidence: 99%

New structural determinants for c‐Myc specific heterodimerization with Max and development of a novel homodimeric c‐Myc b‐HLH‐LZ,

Beaulieu

McDuff

Frappier

et al. 2012

J of Molecular Recognition

Self Cite

View full text Add to dashboard Cite

c-Myc must heterodimerize with Max to accomplish its functions as a transcription factor. This specific heterodimerization occurs through the b-HLH-LZ (basic region, helix 1-loop-helix 2-leucine zipper) domains. In fact, many studies have shown that the c-Myc b-HLH-LZ (c-Myc'SH) preferentially forms a heterodimer with the Max b-HLH-LZ (Max'SH). The primary mechanism underlying the specific heterodimerization lies on the destabilization of both homodimers and the formation of a more stable heterodimer. In this regard, it has been widely reported that c-Myc'SH has low solubility and homodimerizes poorly and that repulsions within the LZ domain account for the homodimer instability. Here, we show that replacing one residue in the basic region and one residue in Helix 1 (H(1)) of c-Myc'SH with corresponding residues conserved in b-HLH proteins confers to c-Myc'SH a higher propensity to form a stable homodimer in solution. In stark contrast to the wild-type protein, this double mutant (L362R, R367L) of the c-Myc b-HLH-LZ (c-Myc'RL) shows limited heterodimerization with Max'SH in vitro. In addition, c-Myc'RL forms highly stable and soluble complexes with canonical as well as non-canonical E-box probes. Altogether, our results demonstrate for the first time that structural determinants driving the specific heterodimerization of c-Myc and Max are embedded in the basic region and H(1) of c-Myc and that these can be exploited to engineer a novel homodimeric c-Myc b-HLH-LZ with the ability of binding the E-box sequence autonomously and with high affinity.

show abstract

Section: Resultsmentioning

confidence: 99%

New structural determinants for c‐Myc specific heterodimerization with Max and development of a novel homodimeric c‐Myc b‐HLH‐LZ,

Beaulieu

McDuff

Frappier

et al. 2012

J of Molecular Recognition

Self Cite

View full text Add to dashboard Cite

show abstract

“…Biotin end‐labeled oligonucleotides (Operon, Huntsville, AL, USA) containing DNA binding motifs were RARE sequences of human RARβ 2 promoter (hβRARE) 5′‐GGGTAGGGTTCACCGAAAGTTCACTCG‐3′ (34, 35), and human E‐box sequences 5′‐TTCCCAGCACAGCCCCATGTGAGAGCTCCCTGGCTC‐3′ (accession no. NW001838432) containing a CANNTG core (36) for nonspecific control. For supershift experiments, rabbit polyclonal anti‐RARα or RXRα antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA) were incubated with GST‐RARα, GST‐S77A, GST‐RXRα, or nuclear protein extracts before addition of the labeled oligonucleotides.…”

Section: Methodsmentioning

confidence: 99%

Loss of CAK phosphorylation of RARa mediates transcriptional control of retinoid‐induced cancer cell differentiation

Wang¹,

Alimova²,

Luo³

et al. 2009

FASEB j.

View full text Add to dashboard Cite

Although the role of the classic retinoic acid (RA)-induced genomic pathway in cancer cell differentiation is well recognized, the underlying mechanisms remain to be dissected. Retinoic acid receptor alpha (RARalpha) is a transcription factor activated by RA, and its serine 77 (RARalphaS77) is the main residue phosphorylated by the cyclin-dependent kinase (CDK)-activating kinase (CAK) complex. We report here that in both human myeloid leukemia and mouse embryonic teratocarcinoma stem cells, either RA-suppressed CAK phosphorylation of RARalpha or mutation of RARalphaS77 to alanine (RARalphaS77A) coordinates CAK-dependent G(1) arrest with cancer cell differentiation by transactivating RA-target genes. Both hypophosphorylated RARalpha and RARalphaS77A reduce binding to retinoic acid-responsive elements (RARE) in the promoters of RA-target genes while stimulating gene transcription. The enhanced transactivation and reduced RARalpha-chromatin interaction are accompanied by RARalpha dissociation from the transcriptional repressor N-CoR and are association with the coactivator NCoA-3. Such effects of decreased CAK phosphorylation of RARalphaS77 on mediating RA-dependent transcriptional control of cancer cell differentiation are examined correspondingly in both RA-resistant myeloid leukemia and embryonic teratocarcinoma stem RARalpha(-/-) cells. These studies demonstrate, for the first time, that RA couples G(1) arrest to transcriptional control of cancer cell differentiation by suppressing CAK phosphorylation of RARalpha to release transcriptional repression.-Wang, A., Alimova, I. N., Luo, P. Jong, A., Triche, T. J., Wu, L. Loss of CAK phosphorylation of RARalpha mediates transcriptional control of retinoid-induced cancer cell differentiation.

show abstract

“…the product of the equilibrium dimerization constant of the b-HLH-LZ in the presence of or on DNA (K Dimer ) and the equilibrium binding constant of the dimeric b-HLH-LZ to DNA (K Binding ). As discussed elsewhere [30], whereas the binding of monomer species can occur at room temperature and constitute a kinetic and transient intermediate state en route to the formation of the final and most stable dimeric state at equilibrium, it is negligible at 37°C [22]. …”

Section: Resultsmentioning

confidence: 99%

Biophysical characterization of the b-HLH-LZ of ΔMax, an alternatively spliced isoform of Max found in tumor cells: Towards the validation of a tumor suppressor role for the Max homodimers

Maltais¹,

Montagne²,

Bédard³

et al. 2017

PLoS ONE

Self Cite

View full text Add to dashboard Cite

It is classically recognized that the physiological and oncogenic functions of Myc proteins depend on specific DNA binding enabled by the dimerization of its C-terminal basic-region-Helix-Loop-Helix-Leucine Zipper (b-HLH-LZ) domain with that of Max. However, a new paradigm is emerging, where the binding of the c-Myc/Max heterodimer to non-specific sequences in enhancers and promoters drives the transcription of genes involved in diverse oncogenic programs. Importantly, Max can form a stable homodimer even in the presence of c-Myc and bind DNA (specific and non-specific) with comparable affinity to the c-Myc/Max heterodimer. Intriguingly, alterations in the Max gene by germline and somatic mutations or changes in the gene product by alternative splicing (e.g. ΔMax) were recently associated with pheochromocytoma and glioblastoma, respectively. This has led to the proposition that Max is, by itself, a tumor suppressor. However, the actual mechanism through which it exerts such an activity remains to be elucidated. Here, we show that contrary to the WT motif, the b-HLH-LZ of ΔMax does not homodimerize in the absence of DNA. In addition, although ΔMax can still bind the E-box sequence as a homodimer, it cannot bind non-specific DNA in that form, while it can heterodimerize with c-Myc and bind E-box and non-specific DNA as a heterodimer with high affinity. Taken together, our results suggest that the WT Max homodimer is important for attenuating the binding of c-Myc to specific and non-specific DNA, whereas ΔMax is unable to do so. Conversely, the splicing of Max into ΔMax could provoke an increase in overall chromatin bound c-Myc. According to the new emerging paradigm, the splicing event and the stark reduction in homodimer stability and DNA binding should promote tumorigenesis impairing the tumor suppressor activity of the WT homodimer of Max.

show abstract

Elucidation of the Structural Determinants Responsible for the Specific Formation of Heterodimeric Mxd1/Max b-HLH-LZ and Its Binding to E-Box Sequences

Cited by 10 publications

References 37 publications

New structural determinants for c‐Myc specific heterodimerization with Max and development of a novel homodimeric c‐Myc b‐HLH‐LZ,

New structural determinants for c‐Myc specific heterodimerization with Max and development of a novel homodimeric c‐Myc b‐HLH‐LZ,

Loss of CAK phosphorylation of RARa mediates transcriptional control of retinoid‐induced cancer cell differentiation

Biophysical characterization of the b-HLH-LZ of ΔMax, an alternatively spliced isoform of Max found in tumor cells: Towards the validation of a tumor suppressor role for the Max homodimers

Contact Info

Product

Resources

About