Elucidation of physico-chemical principles of high-density lipoprotein–small RNA binding interactions

Modulation of the Cellular microRNA Landscape: Contribution to the Protective Effects of High-Density Lipoproteins (HDL)

“…Desgagne et al (2019) demonstrated that the microtranscriptome of HDL differs substantively from that of plasma [117]; notably, a common determining sequence for the export of miRs to HDL has not been reported, although it is clear that this is a selective process, as exported miRNA sequences do not simply reflect the relative abundance of those sequences within cells [21,23]. Most recently, Michell et al (2022) explored the physio-chemical factors influencing the interaction of HDL with small RNA, finding a critical role in the non-ionic interactions with apoA-I [118].…”

High-density lipoproteins mediate small RNA intercellular communication between dendritic cells and macrophages

“…Fluorescence-labelled tRNA-derived sRNA (tDR-GlyGCC: GCAUUGGUGGUUCAGUGGUAGAAUUCUCGC/3AlexF647N, 100 nM, IDT) was denatured and incubated (1:1) with serial dilutions of density-gradient ultracentrifugation (DGUC)-VLDL, DGUC-LDL, or DGUC-HDL in PBS for 5 min and then loaded in glass capillaries (NanoTemper Technologies) and tested on the Monolith NT.115 instrument (NanoTemper Technologies) as previously described ( 12 ). Microscale thermophoresis (MST) traces were acquired using the MO.Control software (v1.6, NanoTemper Technologies) and normalized binding curves from repeated measurements were analyzed using the MO.Affinity Analysis software (v2.3, NanoTemper Technologies).…”

Emerging functional principles of tRNA-derived small RNAs and other regulatory small RNAs

“…Functions based on AGO-independent base pairing include: (I) tsRNA-mediated unfolding of duplexed mRNA structures, thus regulating translation rates ( 137 , 138 ) and (II) tsRNA-regulated the RT of retrovirus (or ERV) by either competing or mimicking the effect of natural tRNA as a primer ( 88 , 139 , 140 ). In more cases, the function of sncRNAs could be categorized as aptamer-like, including: (I) regulation of global protein translation (either inhibit or enhance) in unicellular species and prokaryotes by direct tsRNA–ribosome interaction ( 10 , 38 , 39 , 141 ); (II) tsRNA-mediated cytoplasmic stress granule formation in regulating mRNA translation and/or the displacement of translational initiation factors ( 92 , 142 , 143 ); (III) tsRNA binding to form nuclear RNPs, which in turn, regulate RNA processing inside the nuclei ( 144 , 145 , 146 ); (IV) tsRNA binding with key RBPs to influence their function in regulating metastatic gene expression in cancer progression ( 71 , 72 ); (V) tsRNA and other sncRNAs binding with high-density lipoprotein or low-density lipoprotein in the serum for long-range transportation and activation of TLR ( 132 , 147 ); and (VI) tsRNAs inhibit the association between TSR1 (a ribosome maturation factor) and pre-40S ribosome, leading to a reduction in global protein synthesis ( 148 ). In these cases, the sncRNA functions are exerted independent of RNAi to modulate cellular activity, which might be generalized in more situations, especially for other highly expressed sncRNAs.…”