Elevated Thalamic Dopamine: Possible Link to Sensory Dysfunctions in Schizophrenia

Oke, Arvin F.; Adams, Ralph N.

doi:10.1093/schbul/13.4.589

Cited by 115 publications

(38 citation statements)

References 101 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…An elevated dopamine content has been reported in the thalamus of schizophrenic patients (Oke and Adams, 1987), and in vivo binding has demonstrated low levels of D 2 /D 3 -like dopamine receptors in the thalamus of nonmedicated schizophrenics (Talvik et al, 2003;Yasuno et al, 2004). Moreover, reduced thalamic volume (Andreasen et al, 1994;Buchsbaum et al, 1996) and activity (Buchsbaum et al, 1996), as well as specific activation of the thalamus during hallucinations (Silbersweig et al, 1995), have been reported in schizophrenic patients.…”

Section: Discussionmentioning

confidence: 99%

“…Despite these reports, the notion of a significant and widespread dopamine innervation of the primate thalamus is not currently recognized Guillery, 1996, 2004;Steriade et al, 1997), probably because the dopamine innervation of the rodent thalamus is reportedly scant (Groenewegen, 1988;Papadopoulos and Parnavelas, 1990). However, thalamic abnormalities related to dopamine and its receptors have been found in the thalamus of schizophrenic patients (Oke and Adams, 1987;Talvik et al, 2003;Yasuno et al, 2004), and thalamic alterations exist in Parkinson's disease (Rub et al, 2002), a disorder in which dopamine plays a major role.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

The Primate Thalamus Is a Key Target for Brain Dopamine

Sánchez-González

García‐Cabezas²,

Rico³

et al. 2005

J. Neurosci.

262

187

View full text Add to dashboard Cite

The thalamus relays information to the cerebral cortex from subcortical centers or other cortices; in addition, it projects to the striatum and amygdala. The thalamic relay function is subject to modulation, so the flow of information to the target regions may change depending on behavioral demands. Modulation of thalamic relay by dopamine is not currently acknowledged, perhaps because dopamine innervation is reportedly scant in the rodent thalamus. We show that dopaminergic axons profusely target the human and macaque monkey thalamus using immunolabeling with three markers of the dopaminergic phenotype (tyrosine hydroxylase, dopamine, and the dopamine transporter). The dopamine innervation is especially prominent in specific association, limbic, and motor thalamic nuclei, where the densities of dopaminergic axons are as high as or higher than in the cortical area with the densest dopamine innervation. We also identified the dopaminergic neurons projecting to the macaque thalamus using retrograde tract-tracing combined with immunohistochemistry. The origin of thalamic dopamine is multiple, and thus more complex, than in any other dopaminergic system defined to date: dopaminergic neurons of the hypothalamus, periaqueductal gray matter, ventral mesencephalon, and the lateral parabrachial nucleus project bilaterally to the monkey thalamus. We propose a novel dopaminergic system that targets the primate thalamus and is independent from the previously defined nigrostriatal, mesocortical, and mesolimbic dopaminergic systems. Investigating this "thalamic dopaminergic system" should further our understanding of higher brain functions and conditions such as Parkinson's disease, schizophrenia, and drug addiction.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

The Primate Thalamus Is a Key Target for Brain Dopamine

Sánchez-González

García‐Cabezas²,

Rico³

et al. 2005

J. Neurosci.

262

187

View full text Add to dashboard Cite

show abstract

“…DA transmission in the ventral thalamus has been implicated in the mechanism for prepulse inhibition of the startle reflex (Young et al, 1995), which is abnormal in schizophrenia (Kumari et al, 2000). Moreover, the concentration of DA was elevated in subregions of the thalamus from patients dying with schizophrenia (Oke and Adams, 1987). However, little is known about the origin and function of dopaminergic projections to the thalamus.…”

Section: Discussionmentioning

confidence: 99%

Subchronic Haloperidol Downregulates Dopamine Synthesis Capacity in the Brain of Schizophrenic Patients In Vivo

Gründer¹,

Vernaleken²,

Müller³

et al. 2002

Neuropsychopharmacol

103

View full text Add to dashboard Cite

The antipsychotic effect of neuroleptics cannot be attributed entirely to acute blockade of postsynaptic D 2 -like dopamine (DA) receptors, but may arise in conjunction with the delayed depolarization block of the presynaptic neurons and reduced DA synthesis capacity. Whereas the phenomenon of depolarization block is well established in animals, it is unknown if a similar phenomenon occurs in humans treated with neuroleptics. We hypothesized that haloperidol treatment should result in decreased DA synthesis capacity. We used 6-[ 18 F]fluoro-L-dopa (FDOPA) and positron emission tomography (PET) in conjunction with compartmental modeling to measure the relative activity of DOPA decarboxylase (DDC) (k D 3 , min À1 ) in the brain of nine unmedicated patients with schizophrenia, first in the untreated condition and again after treatment with haloperidol. Patients were administered psychometric rating scales at baseline and after treatment. Consistent with our hypothesis, there was a 25% decrease in the magnitude of k D 3 in both caudate and putamen following 5 weeks of haloperidol therapy. In addition, the magnitudes of k D 3 in cerebral cortex and thalamus were also decreased. Psychopathology as measured with standard rating scales improved significantly in all patients. The decrease of k D 3 in the thalamus was highly significantly correlated with the improvement of negative symptoms. Subchronic treatment with haloperidol decreased the activity of DDC in the brain of patients with schizophrenia. This observation is consistent with the hypothesis that the antipsychotic effect of chronic neuroleptic treatment is associated with a decrease in DA synthesis, reflecting a depolarization block of presynaptic DA neurons. We link an alteration in cerebral catecholamine metabolism in human brain with the therapeutic action of neuroleptic medication.

show abstract

“…Gsh-1 expression is also present in these mature structures at E13.5. The thalamus is an important motor and sensory function integration center (Mojsilovic and Zecevic, 1991) and thalamic disturbances have been associated with Korsakoff syndrome (Squire and Moore, 1979) and schizophrenia (Oke and Adams, 1987;Pakkenberg, 1990). The hypothalamus is also of critical importance, with the paraventricular nucleus, which secretes oxytocin, vasopressin, and corticotropin releasing hormone, and -35 3-36 3-36 3-37 3-38 3-41 3 -43 3-45 3-45 3 -45 3-46 3-46 3-49 3-52 3-52 3-53 3-54 3-55 3-55 3-58 3-59 3-59 CACGTAGGGCGCTAA-GGGTATGC GCATACCCT-GCGCCCTACGTG GACATACAATTCCC-GACTCGGC CATTAAAGGGAGTATTGGCAGTAACGA CCCTCATGAGCCAABCGAGCCTGG TGACCAGCGAAZAAGACACATTA?…”

Section: Gsh-1 Target Dna Binding Sequencementioning

confidence: 99%

Gsh‐1: A novel murine homeobox gene expressed in the central nervous system

Valerius

Stock

et al. 1995

Developmental Dynamics

103

View full text Add to dashboard Cite

We report the characterization of Gsh-1, a novel murine homeobox gene. Northern blot analysis revealed a transcript of approximately 2 kb in sue present at embryonic days 10.5, 11.5, and 12.5 of development. The cDNA sequence encoded a proline rich motif, a polyalanine tract, and a homeodomain with strong homology to those encoded by the clustered Hox genes. The Gsh-1 expression pattern was determined for days E8.5 to E13.5 by whole mount and serial section in situ hybridizations. Gsh-1 transcription was restricted to the central nervous system. Expression is present in the neural tube and hindbrain as two continuous, bilaterally symmetrical stripes within neural epithelial tissue. In the mesencephalon, expression is seen as a band across the most anterior portion. There is also diencephalon expression in the anlagen of the thalamus and the hypothalamus as well as in the optic stalk, optic recess, and the ganglionic eminence. Moreover, through the use of fusion proteins containing the Gsh-I homeodomain, we have determined the consensus DNA binding site of the Gsh-1 homeoprotein to be GCT/cA/,ATTAG/A. 0 1995 Wiley-Liss, Inc.

show abstract

Elevated Thalamic Dopamine: Possible Link to Sensory Dysfunctions in Schizophrenia

Cited by 115 publications

References 101 publications

The Primate Thalamus Is a Key Target for Brain Dopamine

The Primate Thalamus Is a Key Target for Brain Dopamine

Subchronic Haloperidol Downregulates Dopamine Synthesis Capacity in the Brain of Schizophrenic Patients In Vivo

Gsh‐1: A novel murine homeobox gene expressed in the central nervous system

Contact Info

Product

Resources

About