Efficient programming of human mesenchymal stem cell‐derived hepatocytes by epigenetic regulations

Tsai, Wan-Ting; Yeh, Ping Hung; Tsai, Chia Yun; Ting, Chin Tsung; Chiu, Yen Hui; Tao, Mi Hua; Li, Wan Chun; Hung, Shih Chieh

doi:10.1111/jgh.13451

Cited by 5 publications

(4 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Since differentiation processes are largely accompanied by epigenetic modification of genetic regions, we also exposed the cells to 20 µM 5 azacytidine in order to study the effects on the gene expression profile of both naïve and HNF4α-transduced rLEC [15,17,18]. Moreover, it has been shown that the use of DNMTi could trigger cell cycle arrest and promote cellular differentiation in HepG2 cells [15,19]. Furthermore, the addition of DNMTi was shown to significantly improve hepatic features, including phase I and II enzyme activities and higher expression of transcription factors in different cell lines, including HeLa cells, human hepatoma cells and mouse hepatocytes [15,18].…”

Section: Discussionmentioning

confidence: 99%

“…Furthermore, the addition of DNMTi was shown to significantly improve hepatic features, including phase I and II enzyme activities and higher expression of transcription factors in different cell lines, including HeLa cells, human hepatoma cells and mouse hepatocytes [15,18]. Using human mesenchymal stem cells, Tsai and colleagues reported that another DNMTi, called 5-aza-2 -deoxycitidine, together with the histone deacetylase inhibitor (HDACi) trichostatin A (TSA), protects the cells from cell death during their differentiation towards hepatocytes and triggers a wide range of liver-specific markers as well as liver functions [19]. Similar results could, however, not be found when applying the same epigenetic regulators to rat bone marrow-derived mesenchymal stem cells [20].…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Genetic and Epigenetic Modification of Rat Liver Progenitor Cells via HNF4α Transduction and 5’ Azacytidine Treatment: An Integrated miRNA and mRNA Expression Profile Analysis

Bolleyn

Rombaut

Nair

et al. 2020

Genes

View full text Add to dashboard Cite

Neonatal liver-derived rat epithelial cells (rLEC) from biliary origin are liver progenitor cells that acquire a hepatocyte-like phenotype upon sequential exposure to hepatogenic growth factors and cytokines. Undifferentiated rLEC express several liver-enriched transcription factors, including the hepatocyte nuclear factors (HNF) 3β and HNF6, but not the hepatic master regulator HNF4α. In this study, we first investigated the impact of the ectopic expression of HNF4α in rLEC on both mRNA and microRNA (miR) level by means of microarray technology. We found that HNF4α transduction did not induce major changes to the rLEC phenotype. However, we next investigated the influence of DNA methyl transferase (DNMT) inhibition on the phenotype of undifferentiated naïve rLEC by exposure to 5′ azacytidine (AZA), which was found to have a significant impact on rLEC gene expression. The transduction of HNF4α or AZA treatment resulted both in significantly downregulated C/EBPα expression levels, while the exposure of the cells to AZA had a significant effect on the expression of HNF3β. Computationally, dysregulated miRNAs were linked to target mRNAs using the microRNA Target Filter function of Ingenuity Pathway Analysis. We found that differentially regulated miRNA–mRNA target associations predict ectopic HNF4α expression in naïve rLEC to interfere with cell viability and cellular maturation (miR-19b-3p/NR4A2, miR30C-5p/P4HA2, miR328-3p/CD44) while it predicts AZA exposure to modulate epithelial/hepatic cell proliferation, apoptosis, cell cycle progression and the differentiation of stem cells (miR-18a-5p/ESR1, miR-503-5p/CCND1). Finally, our computational analysis predicts that the combination of HNF4α transduction with subsequent AZA treatment might cause changes in hepatic cell proliferation and maturation (miR-18a-5p/ESR1, miR-503-5p/CCND1, miR-328-3p/CD44) as well as the apoptosis (miR-16-5p/BCL2, miR-17-5p/BCL2, miR-34a-5p/BCL2 and miR-494-3p/HMOX1) of naïve rLEC.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Genetic and Epigenetic Modification of Rat Liver Progenitor Cells via HNF4α Transduction and 5’ Azacytidine Treatment: An Integrated miRNA and mRNA Expression Profile Analysis

Bolleyn

Rombaut

Nair

et al. 2020

Genes

View full text Add to dashboard Cite

show abstract

“…Data and materials availability: All of the data that is underlying to this work will be deposited in the public GEO database upon acceptance of the manuscript for publication. (Huch et al, 2015) Custom from ELIM Biopharm CD81 qPCR primers: TGACCACCTCAGTGCTCAAG (F), ATGCCGATGAGGTACAGCTT (R) (Tsai et al, 2017) Custom from ELIM Biopharm Claudin-1 qPCR primers: GAGCGAGTCATGGCCAAC (F), TCTCAATGTCCATTTTCGGTTT (R) (Blanchard et al, 2016) Custom from ELIM Biopharm CYP2B6 qPCR primers: TGGCCGGGGAAAAATCGCCA (F), GAAGAGCTCAAACAGCTGGCCGAA (R) (Huch et al, 2015) Custom from ELIM Biopharm CYP3A4 qPCR primers: TGTGCCTGAGAACACCAGAG (F), GTGGTGGAAATAGTCCCGTG (R) (Huch et al, 2015) Custom from ELIM Biopharm LGR5 qPCR primers: GACTTTAACTGGAGCACAGA (F), AGCTTTATTAGGGATGGCAA (R) (Huch et al, 2015) Custom from ELIM Biopharm Occludin qPCR primers: TGCATGTTCGACCAATGC (F), AAGCCACTTCCTCCATAAGG (R) (Benedicto et al, 2009) Custom from ELIM Biopharm SR-BI qPCR primers: TCCTCACTTCCTCAACGCTG (F), TCCCAGTTTGTCCAATGCC (R) (Zheng et al, 2013) Custom from ELIM Biopharm HCV qPCR & ddPCR primers: CGGGAGAGCCATAGTGG (F), AGTACCACAAGGCCTTTCG (R), CTGCGGAACCGGTGAGTACAC (FAM probe) (Wakita et al, 2005) Custom from ELIM Biopharm HCV ddPCR negative strand primers: GGCCGTCATGGTGGCGAATAAGCCTAGCCATGGCGTTAGTA (for reverse transcription), GGCCGTCATGGTGGCGAATAA (F), CTCCCGGGGCACTCGCAAGC (R), AGTGTCGTACAGCCTCCAGGC (HEX probe) (Klepper et al, 2017)…”

Section: Competing Interests: No Competing Interests To Reportmentioning

confidence: 99%

Hepatitis C Virus Infects and Perturbs Liver Stem Cells

Meyers

Ashuach

Lyons

et al. 2021

Preprint

View full text Add to dashboard Cite

SummaryHepatitis C virus (HCV) is the leading cause of death from liver disease. How HCV infection causes lasting liver damage and increases cancer risk beyond viral clearance remains unclear. We identify bipotent liver stem cells as novel targets for HCV infection, and their erroneous differentiation as the potential cause of impaired liver regeneration and cancer development. We show 3D organoids generated from liver stem cells from actively HCV-infected individuals carry replicating virus and maintain low-grade infection over months. Organoids can be infected with a primary HCV isolate. Virus-inclusive single-cell RNA-sequencing uncovered extensive transcriptional reprogramming in HCV+ cells supporting hepatocytic differentiation, cancer stem cell development and viral replication while stem cell proliferation and interferon signaling are disrupted. Our data adds a pathogenesis factor – infection of liver stem cells – to the biology of HCV infection that explains persistent liver damage and enhanced cancer risk through an altered stem cell state.

show abstract

“…In recent years, MSC have also been utilized for the generation of mesenchymal as well as non-mesenchymal cell lineages, including neuron-like, hepatocyte-like, and cardiac-like cells [6][7][8][9][10]. Despite these promising results, the differentiation of human MSC into fully mature cardiomyocytes bearing all their respective phenotypical and functional characteristics is difficult [11][12][13][14][15].…”

Section: Introductionmentioning

confidence: 99%

RNA-Based Strategies for Cardiac Reprogramming of Human Mesenchymal Stromal Cells

Mueller

Wolfien

Ekat

et al. 2020

Cells

View full text Add to dashboard Cite

Multipotent adult mesenchymal stromal cells (MSCs) could represent an elegant source for the generation of patient-specific cardiomyocytes needed for regenerative medicine, cardiovascular research, and pharmacological studies. However, the differentiation of adult MSC into a cardiac lineage is challenging compared to embryonic stem cells or induced pluripotent stem cells. Here we used non-integrative methods, including microRNA and mRNA, for cardiac reprogramming of adult MSC derived from bone marrow, dental follicle, and adipose tissue. We found that MSC derived from adipose tissue can partly be reprogrammed into the cardiac lineage by transient overexpression of GATA4, TBX5, MEF2C, and MESP1, while cells isolated from bone marrow, and dental follicle exhibit only weak reprogramming efficiency. qRT-PCR and transcriptomic analysis revealed activation of a cardiac-specific gene program and up-regulation of genes known to promote cardiac development. Although we did not observe the formation of fully mature cardiomyocytes, our data suggests that adult MSC have the capability to acquire a cardiac-like phenotype when treated with mRNA coding for transcription factors that regulate heart development. Yet, further optimization of the reprogramming process is mandatory to increase the reprogramming efficiency.

show abstract

Efficient programming of human mesenchymal stem cell‐derived hepatocytes by epigenetic regulations

Abstract: The present study successfully established a protocol to direct hMSCs into hepatocyte-like cells suggesting the beneficial impact to apply HDACi and DNMTi as potent modulators for hMSCs to liver differentiation.

Cited by 5 publications

References 53 publications

Genetic and Epigenetic Modification of Rat Liver Progenitor Cells via HNF4α Transduction and 5’ Azacytidine Treatment: An Integrated miRNA and mRNA Expression Profile Analysis

Genetic and Epigenetic Modification of Rat Liver Progenitor Cells via HNF4α Transduction and 5’ Azacytidine Treatment: An Integrated miRNA and mRNA Expression Profile Analysis

Hepatitis C Virus Infects and Perturbs Liver Stem Cells

RNA-Based Strategies for Cardiac Reprogramming of Human Mesenchymal Stromal Cells

Contact Info

Product

Resources

About