Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System &lt;em&gt;Danio rerio&lt;/em&gt;

Sorlien, Erin L; Witucki, Mary A.; Ogas, Joe

doi:10.3791/56969-v

Cited by 5 publications

(9 citation statements)

References 21 publications

(21 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…One-cell stage zebrafish embryos were injected with a final concentration of Cas9 mRNA (400 ng/μl) and sgRNA (100 ng/μl). The efficiency of each sgRNA was assessed using a heteroduplex shift assay ( 93 ) with specific primers (table S3). The injected F0 generation of CRISPR-Cas9 was raised and outcrossed to WTs.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Hox genes control homocercal caudal fin development and evolution

Cumplido,

Arratia,

Desvignes

et al. 2024

Sci. Adv.

View full text Add to dashboard Cite

Ancient bony fishes had heterocercal tails, like modern sharks and sturgeons, with asymmetric caudal fins and a vertebral column extending into an elongated upper lobe. Teleost fishes, in contrast, developed a homocercal tail characterized by two separate equal-sized fin lobes and the body axis not extending into the caudal fin. A similar heterocercal-to-homocercal transition occurs during teleost ontogeny, although the underlying genetic and developmental mechanisms for either transition remain unresolved. Here, we investigated the role of hox13 genes in caudal fin formation as these genes control posterior identity in animals. Analysis of expression profiles of zebrafish hox13 paralogs and phenotypes of CRISPR/Cas9-induced mutants showed that double hoxb13a and hoxc13a mutants fail to form a caudal fin. Furthermore, single mutants display heterocercal-like morphologies not seen since Mesozoic fossil teleosteomorphs. Relaxation of functional constraints after the teleost genome duplication may have allowed hox13 duplicates to neo- or subfunctionalize, ultimately contributing to the evolution of a homocercal tail in teleost fishes.

show abstract

Section: Methodsmentioning

confidence: 99%

“…Genotyping was performed using a heteroduplex mobility shift assay ( 93 ) (fig. S4C) to identify mutations using genomic DNA provided by clipping the anal fin of adult fish.…”

Section: Methodsmentioning

confidence: 99%

Hox genes control homocercal caudal fin development and evolution

Cumplido,

Arratia,

Desvignes

et al. 2024

Sci. Adv.

View full text Add to dashboard Cite

show abstract

“…A mixture of gRNA (200 ng/μl) and TrueCut Cas9 Protein v2 (500 ng/μl; Invitrogen) was injected into the cytoplasm of fertilized zebrafish eggs. Mutations were analyzed using a previously described procedure ( 80 ). Briefly, injected embryos were extracted at 24 hpf and subjected to PCR with the primer set z pou5f3 -genome-f and z pou5f3 -genome-r (table S3).…”

Section: Methodsmentioning

confidence: 99%

Mature mRNA processing that deletes 3′ end sequences directs translational activation and embryonic development

Takada,

Fierro,

Sato

et al. 2023

Sci. Adv.

View full text Add to dashboard Cite

Eggs accumulate thousands of translationally repressed mRNAs that are translated into proteins after fertilization to direct diverse developmental processes. However, molecular mechanisms underlying the translation of stored mRNAs after fertilization remain unclear. Here, we report a previously unknown RNA processing of 3′ end sequences of mature mRNAs that activates the translation of stored mRNAs. Specifically, 9 to 72 nucleotides at the 3′ ends of zebrafish pou5f3 and mouse Pou5f1 mRNAs were deleted in the early stages of development. Reporter assays illustrated the effective translation of the truncated forms of mRNAs. Moreover, promotion and inhibition of the shortening of 3′ ends accelerated and attenuated Pou5f3 accumulation, respectively, resulting in defective development. Identification of proteins binding to unprocessed and/or processed mRNAs revealed that mRNA shortening acts as molecular switches. Comprehensive analysis revealed that >250 mRNAs underwent this processing. Therefore, our results provide a molecular principle that triggers the translational activation and directs development.

show abstract

“…sgRNA3F:5' TTTTGCTGGTGTCTGCAGGA 3'; R: 5' TAAAGCTGTTCAGGGGTGGC 3'3) tyrosinase crispant embryoAs a control embryo, 200 ng /uL of a sgRNA targeting tyrosinase gene(Sorlien et al, 2018) was injected with 500 ng/uL of Cas9 protein. Cas9-induced indel formation at the tyrosinase gene results in loss of pigmentation.…”

mentioning

confidence: 99%

Versican controlled by Lmx1b regulates hyaluronate density and hydration for semicircular canal morphogenesis

Mori,

Smith,

Wang

et al. 2024

Preprint

View full text Add to dashboard Cite

During inner ear semicircular canal morphogenesis in zebrafish, patterned canal-genesis zones express genes for extracellular matrix component synthesis. These include hyaluronan and the hyaluronan-binding chondroitin sulfate proteoglycan Versican, which are abundant in the matrices of many developing organs. Charged hyaluronate polymers play a key role in canal morphogenesis through osmotic swelling. However, the developmental factor(s) that control the synthesis of the matrix components and regulation of hyaluronate density and swelling are unknown. Here, we identify the transcription factor, Lmx1b, as a positive transcriptional regulator of hyaluronan, Versican, and chondroitin synthesis genes crucial for canal morphogenesis. We show that Versican regulates hyaluronan density through its protein core, whereas the charged chondroitin side chains contribute to the osmotic swelling of hyaluronate. Versican-tuned properties of hyaluronate matrices may be a broadly used mechanism in morphogenesis with important implications for understanding diseases where these matrices are impaired, and for hydrogel engineering for tissue regeneration.

show abstract

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System <em>Danio rerio</em>

Cited by 5 publications

References 21 publications

Hox genes control homocercal caudal fin development and evolution

Hox genes control homocercal caudal fin development and evolution

Mature mRNA processing that deletes 3′ end sequences directs translational activation and embryonic development

Versican controlled by Lmx1b regulates hyaluronate density and hydration for semicircular canal morphogenesis

Contact Info

Product

Resources

About