Efficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage

Zhang, Jianping; Li, Xiaolan; Li, Guohua; Chen, Wanqiu; Arakaki, Cameron; Botimer, Gary D.; Baylink, David J.; Zhang, Lu; Wen, Wei; Fu, Ya-Wen; Xu, Jing; Chun, Noah; Yuan, Weiping; Cheng, Tao; Zhang, Xiaobing

doi:10.1186/s13059-017-1164-8

Cited by 369 publications

(372 citation statements)

References 66 publications

(102 reference statements)

Supporting

Mentioning

348

Contrasting

Unclassified

Order By: Relevance

“…Moreover, RaPID cannot distinguish between directly interacting proteins or proteins that engage indirectly with RNA, and it cannot be used to study endogenous RNAs at their physiological concentrations. The latter limitation, however, may be addressed in the future by increasingly efficient approaches to homology-directed recombinatorial knock-in technologies, which may permit incorporation of BoxB sites into endogenous RNA sequences expressed from native regulatory elements 38 .…”

Section: Discussionmentioning

confidence: 99%

RNA–protein interaction detection in living cells

et al. 2018

View full text Add to dashboard Cite

RNA–protein interactions play numerous roles in cellular function and disease. Here we describe RNA–protein interaction detection (RaPID), which uses proximity-dependent protein labeling, based on the BirA* biotin ligase, to rapidly identify the proteins that bind RNA sequences of interest in living cells. RaPID displays utility in multiple applications, including in evaluating protein binding to mutant RNA motifs in human genetic disorders, in uncovering potential post-transcriptional networks in breast cancer, and in discovering essential host proteins that interact with Zika virus RNA. To improve the BirA*-labeling component of RaPID, moreover, a new mutant BirA* was engineered from Bacillus subtilis, termed BASU, that enables >1,000-fold faster kinetics and >30-fold increased signal-to-noise ratio over the prior standard Escherichia coli BirA*, thereby enabling direct study of RNA–protein interactions in living cells on a timescale as short as 1 min.

show abstract

Section: Discussionmentioning

confidence: 99%

RNA–protein interaction detection in living cells

et al. 2018

View full text Add to dashboard Cite

show abstract

“…Others described an increase of knock-in efficiency in HEK cells 15,17 , while others found no significant effect in rabbit embryos 18 and human stem cells 14,19 . Recently, Greco et al reanalysed the structure and inhibitory properties of SCR7 20 and concluded that SCR7 and its derivates are neither selective nor potent inhibitors of human DNA ligase IV.…”

mentioning

confidence: 99%

“…Recently, Greco et al reanalysed the structure and inhibitory properties of SCR7 20 and concluded that SCR7 and its derivates are neither selective nor potent inhibitors of human DNA ligase IV. Inhibition of DNA-PK in the NHEJ-pathway by the small molecules NU7441 and NU7026 has been shown to reduce the frequency of NHEJ and to increase efficiency of knock-ins in HEK cells (from 1.9 to 3.8%; from 3 to 7.6%) 21,22 and hiPSCs (from 13 to 16%) 19 and of TNS in mouse embryonic fibroblasts (from 3 to 10%) 21 . The RAD51 stimulatory compound RS-1 increased knock-in efficiency in rabbit embryos (from 4.4 to 26.1%) 18 , HEK cells (from 3.5 to 21%) 17 and U2OS cells (from 1.9 to 2.4%) 17 , but not in hiPSCs 19 .…”

mentioning

confidence: 99%

Targeting repair pathways with small molecules increases precise genome editing in pluripotent stem cells

Riesenberg

Maričić

2017

Preprint

View full text Add to dashboard Cite

A now frequently used method to edit mammalian genomes uses the nucleases CRISPR/Cas9 and CRISPR/Cpf1 or the nickase CRISPR/Cas9n to introduce double-strand breaks (DSBs) which are then repaired by homology-directed repair (HDR) using synthetic or cloned DNA donor molecules carrying desired mutations. However, another pathway, the non-homologous end joining (NHEJ) pathway competes with HDR for repairing DNA breaks in cells. To increase the frequency of precise genome editing in human induced pluripotent stem cells (hiPSCs) and human embryonic stem cells (hESCs) we have tested the capacity of a number of small molecules to enhance HDR or inhibit NHEJ. We identify molecules that increase the frequency of precise genome editing including some that have additive effects when applied together. Using a mixture of such molecules, the 'CRISPY' mix, we achieve 2.8-to 6.7-fold increase in precise genome editing with Cas9n, resulting in the introduction of the intended nucleotide substitutions in almost 50% of chromosomes, to our knowledge the highest editing efficiency in hiPSCs described to date. Furthermore, the CRISPY mix improves precise genome editing with Cpf1 2.9-to 4.0-fold, allowing almost 20% of chromosomes to be edited. Main textThe bacterial nuclease CRISPR/Cas9 is now frequently used to accurately cut chromosomal DNA sequences in eukaryotic cells. The resulting DNA breaks are repaired by two competing pathways: NHEJ and HDR (Fig. 1). In NHEJ, the first proteins to bind the cut DNA ends are Ku70/Ku80, followed by DNA protein kinase catalytic subunit (DNA-PKcs) Since NHEJ of Cas9-induced DSBs is error prone and frequently introduces short insertions and deletions (indels) at the cut site, it is useful for knocking out a targeted gene. In contrast, HDR allows precise repair of a DSB by using a homologous donor DNA. If the donor DNA provided in the experiment carries mutations, these will be introduced into the genome (precise genome editing). Repair with homologous ssDNA or dsDNA has been suggested to engage different pathways 5 . We will refer to Targeted Nucleotide Substitutions using ssDNA donors as 'TNS' and targeted insertion of cassettes . CC-BY-NC-ND 4.0 International license not peer-reviewed) is the author/funder. It is made available under a The copyright holder for this preprint (which was . http://dx.doi.org/10.1101/136374 doi: bioRxiv preprint first posted online May. 10, 2017; 3 using dsDNA donors as knock-ins, respectively. In order to introduce a DSB Cas9 requires the nucleotide sequence NGG (a "PAM" site) in the target DNA. Targeting of Cas9 is further determined by a guide RNA (gRNA) complementary to 20 nucleotides adjacent to the PAM site. However, the Cas9 may also cut the genome at sites that carry sequence similarity to the gRNA 6 . One strategy to reduce such off-target cuts is to use a mutated Cas9 that introduces single-stranded nicks instead of DSBs (Cas9n) 7 . Using two gRNAs to introduce two nicks on opposite DNA strands in close proximity to each other will result in a staggered D...

show abstract

“…Specifically, we inserted CRISPR-Tag into the 3' UTR region of human H2B by CRISPR knock-in using electroporation of Cas9/sgRNA ribonucleoprotein complexes (RNPs) 11 and double-cut plasmid donor 12 , which could increase targeting specificity and efficiency, respectively (diagram in Supplementary Fig. 3).…”

Section: Main Textmentioning

confidence: 99%

“…To generate donor plasmids harboring sgH2B recognition sites, termed double-cut donor plasmid, the sgH2B targeting sequence together with the PAM sequence (GCGAGCGCCAGGTCCCGGCAGGG) was included in the forward primer of left HA and the reverse primer of right HA. Therefore, sgH2B targeting sequence was tagged to the regions flanking the upstream and downstream HA as previously described 12 .…”

Section: Cc-by-nc 40 International License Not Peer-reviewed) Is Thementioning

confidence: 99%

CRISPR-Tag: an Efficient DNA Tagging System in Living Cells

Chen

Zou

2018

Preprint

View full text Add to dashboard Cite

Main textA lack of efficient tools to image non-repetitive genes in living cells has limited our ability to explore the functional impact of spatiotemporal dynamics of genes. Here, we addressed this issue by developing the CRISPR-Tag system as a new DNA tagging strategy to label protein-coding genes with high signal-to-noise ratio under wild-field fluorescence microscopy by using 1 to 4 highly active sgRNAs. The CRISPR-Tag, with minimal size of ∼ 250 bp, represents an easily and broadly applicable technique to study spatiotemporal organization of genomic elements in living cells.

show abstract

Efficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage

Cited by 369 publications

References 66 publications

RNA–protein interaction detection in living cells

RNA–protein interaction detection in living cells

Targeting repair pathways with small molecules increases precise genome editing in pluripotent stem cells

CRISPR-Tag: an Efficient DNA Tagging System in Living Cells

Contact Info

Product

Resources

About