Efficient in vivo manipulation of mouse genomic sequences at the zygote stage.

Lakso, Merja; Pichel, José G.; Gorman, James R.; Sauer, Brian; Okamoto, Y; Lee, Eric; Alt, Frederick W.; Westphal, Heiner

doi:10.1073/pnas.93.12.5860

Cited by 1,035 publications

(968 citation statements)

References 15 publications

Supporting

Mentioning

940

Contrasting

Unclassified

Order By: Relevance

“…The genotypes of all offspring were analysed by polymerase chain reaction or Southern blot analysis on tail-tip DNA. To generate PGDSCre mice, PGDSCre floxGFPHygro/ þ mice were crossed with EIIACre deletor transgenic mice (Lakso et al, 1996). In the deriving double transgenic offspring XbaI-NdeI digested tail DNA, the PGDSCre allele (13.0 kb) was detected by Southern blot with probe A.…”

Section: Methodsmentioning

confidence: 99%

Identification of a progenitor cell of origin capable of generating diverse meningioma histological subtypes

et al. 2011

View full text Add to dashboard Cite

Meningiomas are among the most common primary central nervous system tumours in adults. Studies focused on the molecular basis for meningioma development are hampered by a lack of information with regard to the cell of origin for these brain tumours. Herein, we identify a prostaglandin D synthase-positive meningeal precursor as the cell of origin for murine meningioma, and show that neurofibromatosis type 2 (Nf2) inactivation in prostaglandin D2 synthase (PGDS) ( þ ) primordial meningeal cells, before the formation of the three meningeal layers, accounts for the heterogeneity of meningioma histological subtypes. Using a unique PGDSCre strain, we define a critical embryonic and early postnatal developmental window in which biallelic Nf2 inactivation in PGDS ( þ ) progenitor cells results in meningioma formation. Moreover, we identify differentially expressed markers that characterize the two major histological meningioma subtypes both in human and mouse tumours. Collectively, these findings establish the cell of origin for these common brain tumours as well as a susceptible developmental period in which signature genetic mutations culminate in meningioma formation.

show abstract

Section: Methodsmentioning

confidence: 99%

Identification of a progenitor cell of origin capable of generating diverse meningioma histological subtypes

et al. 2011

View full text Add to dashboard Cite

show abstract

“…Both assays confirmed that homologously recombined mutant allele was transmitted through the germline. These mice were then mated with Ella-Cre + mice (Lakso et al, 1996) in order to delete exons 2 and 3 from the mutant allele by Cre-dependent homologous recombination between the two loxP sites (Fig. 1B,C).…”

Section: Construction Of a Tead2 Conditional Knock-out Allelementioning

confidence: 99%

Transcription factor TEAD2 is involved in neural tube closure

Kaneko

Kohn

Liu

et al. 2007

Genesis

View full text Add to dashboard Cite

Summary-TEAD2, one of the first transcription factors expressed at the beginning of mammalian development, appears to be required during neural development. For example, Tead2 expression is greatest in the dorsal neural crest where it appears to regulate expression of Pax3, a gene essential for brain development. Consistent with this hypothesis, we found that inactivation of the Tead2 gene in mice significantly increased the risk of exencephaly (a defect in neural tube closure). However, none of the embryos exhibited spina bifida, the major phenotype of Pax3 nullizygous embryos, and expression of Pax3 in E11.5 Tead2 nullizygous embryos was normal. Thus, Tead2 plays a role in neural tube closure that is independent of its putative role in Pax3 regulation. In addition, the risk of exencephaly was greatest with Tead2 nullizygous females, and could be suppressed either by folic acid or pifithrin-α. These results reveal a maternal genetic contribution to neural tube closure, and suggest that Tead2-deficient mice provide a model for anencephaly, a common human birth defect that can be prevented by folic acid. genesis 45:577-587, 2007.

show abstract

“…The aHPV18 transgene was built from the previously described maA-loxP-TAg construct (Lakso et al, 1996) by inserting an HPV18 E6/E7 open reading frame derived from p18-L67A Romanczuk et al, 1991). The BglII ± HindIII HPV18 E6/E7 insert was generated by PCR, using the 5' primer GGAGA TCTGAAACACACCACTACTATGGCG and the 3' primer GGAAGCTTTGTTGCTTACTGCTGGGATGCA-CA.…”

Section: Transgene Construction and Production Of Transgenic Micementioning

confidence: 99%

A human papillomavirus type 18 E6/E7 transgene sensitizes mouse lens cells to human wild-type p53-mediated apoptosis

1997

View full text Add to dashboard Cite

We have studied the concerted action of factors that in¯uence the balance between cell proliferation and cell death in the developing lens of transgenic mice. We show that a human papillomavirus type 18 (HPV18) E6/E7 transgene that predominantly expresses the viral E7 gene product triggers apoptosis in a dose dependent manner, and causes retardation of lens growth or microphakia. E7 is known to inactivate pRB, the product of the retinoblastoma gene, and to enhance the action of p53. Our earlier work had demonstrated that over-expression of p53 itself can cause apoptosis of lens cells, and that a mutant p53 allele can interfere with this process. In the present study, we examined lenses that simultaneously express di erent constellations of the HPV18 E6/E7, wild-type and mutant human p53, and wild-type human pRB transgenes. We observed that lens cells expressing the HPV18 transgene are more sensitive to wild-type human p53 action than normal lens cells. As a result, there is severe microphakia in lenses that express both the HPV18 and the wild-type p53 transgenes. By contrast, apoptosis was reduced in lenses that coexpressed the HPV18 and either the pRB or the mutant p53 transgene. We conclude that levels of wild-type p53 are critical, and that any excess of p53 or suppression of pRB can cause cell death. Our results encourage attempts to counteract the deleterious action of human papillomaviruses in cervical cancer by a combination of measures that decrease cell proliferation and enhance apoptosis.

show abstract

Efficient in vivo manipulation of mouse genomic sequences at the zygote stage.

Cited by 1,035 publications

References 15 publications

Identification of a progenitor cell of origin capable of generating diverse meningioma histological subtypes

Identification of a progenitor cell of origin capable of generating diverse meningioma histological subtypes

Transcription factor TEAD2 is involved in neural tube closure

A human papillomavirus type 18 E6/E7 transgene sensitizes mouse lens cells to human wild-type p53-mediated apoptosis

Contact Info

Product

Resources

About