Efficient CRISPR/Cas9-mediated gene disruption in the tetraploid protist Giardia intestinalis

Abstract

CRISPR/Cas9-mediated genome editing has become an extremely powerful technique used to modify gene expression in many organisms, including parasitic protists. Giardia intestinalis , a protist parasite that infects approximately 280 million people around the world each year, has been eluding the use of CRISPR/Cas9 to generate knockout cell lines due to its tetraploid genome. In this work, we show the ability of the in vitro assembled CRISPR/Cas9 components to successfully edit the genome of G. intestinalis . The cell line that stably expresses Cas9 in both nuclei of G. intestinalis showed effective recombination of the cassette containing the transcription units for the gRNA and the resistance marker. This highly efficient process led to the removal of all gene copies at once for three independent experimental genes, mem , cwp1 and mlf1. The method was also applicable to incomplete disruption of the essential gene, as evidenced by significantly reduced expression of tom40. Finally, testing the efficiency of Cas9-induced recombination revealed that homologous arms as short as 150 bp can be sufficient to establish a complete knockout cell line in G. intestinalis .

Identification of target genes regulated by encystation-induced transcription factor Myb2 using knockout mutagenesis in Giardia lamblia

“…The development of drug markers other than neomycin, puromycin, and blasticidin will accelerate research on the improvement of genetic technology in Giardia . The knockout methodology recently reported by Horáčková et al [ 27 ] was fundamentally similar as we did. However, they suggested that their method was a highly efficient process for removing non-essential genes ( mem , cwp1 , and mlf1 ) in a one-step process and used fluorescence in situ hybridization to identify a deletion mutant.…”

“…The CRISPR system using nuclease-dead Cas9, instead of Cas9, was developed and successfully knocked down the expression of motor proteins, kinesin-2a and kinesin-13, and a ventral disc protein [ 26 ]. Recently, Horáčková et al [ 27 ] attempted genome editing using an in vitro assembled CRISPR/Cas9 component, but they had no success. Instead, they made a knockout mutant of three genes [ mem (multiple high cysteine membrane), cwp1 and mlf1 ] using a Cas9-expressing cell line.…”

The late ISC pathway interactome reveals mitosomal-cytoplasmic crosstalk in Giardia intestinalis

“…Having established the integration of Gi BolA within the mitosomal late ISC pathway, we next examined the role of BolA in the formation of Fe-S clusters. To this aim, using the recently established CRISPR/Cas9-mediated gene knockout approach (60) and a G. intestinalis cell line lacking bolA gene (ΔbolA) was generated (Fig. 4B, 4C).…”

“…For CRISPR/Cas9-mediated knockout of bolA gene, gRNA sequence ATCAGCTCTCCCGACTTCAA was inserted into gRNA cassette of pTGuide vector using (60) two annealed oligonucleotides (see Supplementary Table 5 for primers and restriction enzymes used). The 999 bp of 5’ and 940 bp 3’ homologous arms surrounding bolA gene were inserted into pTGuide vector as the homologous arms for the recombination of the resistance cassette (Supplementary Table 5).…”

Trophozoite fitness dictates the intestinal epithelial cell response to Giardia intestinalis infection

“…Moreover, the newly introduced G . intestinalis adapted CRISPR/Cas9 method will make it possible to efficiently create gene knockouts in the parasite [ 78 ], as well as in the IECs [ 79 ]. The combination of genetically modified G .…”