Efficiency of PCR-RFLP and species-specific PCR for the identification of meat origin in dry sausages

Kušec, Ivona Djurkin; Samac, Danijela; Margeta, Vladimir; Radišić, Žarko; Vincek, Dragutin; Kušec, Goran

doi:10.17221/243/2016-cjfs

Cited by 11 publications

(5 citation statements)

References 26 publications

(33 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The extreme sensitivity of the real time PCR technique is mentioned in the literature [ 3 , 15 , 16 ]. However, it was also reported that the mixing distributes the ingredients through the sausage in an unpredictable manner [ 17 ]. Thus, addition or cross contamination of small amounts of chicken meat might not be distributed thoroughly in sausages.…”

Section: Resultsmentioning

confidence: 99%

Sequential use of real-time polymerase chain reaction and enzyme-linked immunosorbent assay techniques verifies adulteration of fermented sausages with chicken meat

Benli

Barutcu

2021

Anim Biosci

View full text Add to dashboard Cite

Objective: Detection of adulteration in processed meats is an important issue for some countries due to substitution of beef with a cheaper source of protein like poultry. In this study, the presence of chicken meat was investigated using real-time polymerase chain reaction (Real-time PCR) and enzyme-linked immunosorbent assay (ELISA) techniques to verify adulteration of fermented sausage samples.Methods: A total of 60 commercial samples were collected from 20 establishments in three replicates including 10 fermented sausage manufacturers and 10 butchers to investigate the presence of chicken meat with the sequential use of Real-time PCR and ELISA techniques. In addition pH, moisture content, water activity, and color and textural propertiesvalues of the samples were determined.Results: Both Real-time PCR and ELISA showed agreement on the presence or absence of chicken meat in 55 out of 60 fermented sausage samples and chicken meat was identified with both methods in 16 samples. Five samples produced inconsistent results for the presence of the chicken meat in the first run. Nevertheless the presence of chicken meat was verified with the both methods when these samples were analyzed for the second time. In addition, the average physico-chemical values of the fermented sausage samples tested positive for chicken meat were not significantly different from some of those fermented sausage samples tested negative for the chicken meat. Conclusion:The sequential use of Real-time PCR and ELISA techniques in fermented sausages could be beneficial for the government testing programs in order to eliminate false negatives for detection of adulteration with chicken meat. Furthermore, consumers would should not rely on some of the quality cues including color to predict the adulteration of fermented sausages with chicken meat since there were no statistical differences between among some of the samples tested positive and negative for chicken meat.

show abstract

Section: Resultsmentioning

confidence: 99%

Sequential use of real-time polymerase chain reaction and enzyme-linked immunosorbent assay techniques verifies adulteration of fermented sausages with chicken meat

Benli

Barutcu

2021

Anim Biosci

View full text Add to dashboard Cite

show abstract

“…The AuNPs were conjugated with specific oligonucleotides for cow mitochondrial DNA: sense primer GCCATATACTCTCCTTGGTGACA and antisense primer GTAGGCTTGGGAATAGTACGA (Invitrogen™, USA). The oligonucleotides were modified with 10xdATP in the 5′-end of the primer and thiolated (Cheng et al, 2006;Lahiff et al, 2001;Kusec et al, 2017). The AuNPs were conjugated with the oligonucleotides by adding 1 ml of AuNPs into 4 nmol of the oligonucleotides using a previously described protocol by Hill and Mirkin (2006).…”

Section: Preparation Of Gold Nanoparticle Probesmentioning

confidence: 99%

Effectual Gold Nanoprobe Sensor for Screening Cow Milk Adulteration in Goat Milk—Comparison With Conventional PCR

Ortiz¹,

Tsouknidas²,

Pytel³

et al. 2021

JAS

View full text Add to dashboard Cite

Different methods have been used to detect milk adulteration, but in recent years the use of nanomaterials has been introduced as an interesting tool, due to their optical properties. A gold nanoparticle (AuNP) probe application was developed in order to evaluate milk adulteration. The methodology relies on the colorimetric differentiation and the participation profiles of the hybridization DNA sequence with the AuNPs. Various concentrations, from 0.01 (traces) to 50%, of cows’ milk in goats’ milk samples were prepared for DNA extraction, further identification with the AuNPs and comparison with a conventional PCR. Also, a total of 40 dairy products from goat milk, commonly consumed in Greece, were tested. Negative and goat reaction mixtures showed a purplish coloured solution with a peak at > 570 nm, while samples containing bovine DNA had an absorbance closer to the characteristic peak of the AuNPs at 520-525 nm. Presence of bovine milk was detected even at traces level, achieving a detection level comparable to those achieved by conventional PCR. The use of AuNPs in milk products, provides a low-cost and easy-to-perform method and offers the possibility to detect fraudulent practices in various food matrices.

show abstract

“…55 The same results observed in domestic animals using PCR-RFLP were obtained in assessing the possible adulteration of sausage products made with chicken. 56 Moreover, PCR-RFLP has also been considered in the study of some growth and performance traits. 57 However, PCR-SSCP was considered as a cornerstone in recent post-PCR genotyping studies on poultry, such as egg-production traits, body weight characteristics, and intramuscular fat content.…”

Section: Applicationsmentioning

confidence: 99%

“…[62][63][64] With respect to fish and amphibians, species identification and the detection of environmental samples and closely related organisms were recently conducted using PCR-RFLP. [56][57][58][59][60][61][62][63][64][65][66][67][68] The PCR-SSCP was used in the detection of parasite species. 69 The ease of the use of PCR-RFLP was demonstrated in its successful implementation in species identification and discrimination in algae, bacteria, and fungi.…”

Section: Parameter Of Comparison Pcr-rflp Pcr-sscpmentioning

confidence: 99%

Exploring the Potential and Limitations of PCR-RFLP and PCR-SSCP for SNP Detection: A Review

Hashim

Al-Shuhaib

2019

J Apple Biotechnol Rep

View full text Add to dashboard Cite

Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) and PCR-restriction fragment length polymorphism (PCR-RFLP) are two independent methods used in the post-amplification genotyping of DNA variations. Both techniques are used in a wide range of screening applications to characterize single nucleotide polymorphisms (SNPs). The PCR-SSCP enables the identification of a potentially causative unknown SNP that could not be identified by PCR-RFLP. However, because complicated steps are not required to perform PCR-RFLP, it is used in many applications. On the other hand, PCR-RFLP is easier to process in terms of time and handover experience, the detection of a particular unknown SNP by PCR-SSCP has further chances. The simplicity of PCR-RFLP does not mean that it is better than PCR-SSCP. The reason is the limited ability of PCR-RFLP to detect nucleotide variations, which often go undetected because each restriction enzyme (RE) scans only a few recognition sequences, and other sequences are ignored. Furthermore, the efficacy of PCR-SSCP is sometimes hindered by many optimizations and also lack of experience. As PCR-SSCP allows other sequences within an amplicon to be separated and characterized, the choice between PCR-RFLP and PCR-SSCP is largely dependent on the reason for each genotyping experiment. This review provides a useful guide for comparing PCR-RFLP and PCR-SSCP in terms of their concepts, efficiency, ease of use, interpretation, and sensitivity as well as several other parameters. The comparison is extended to the practical applications of both techniques in terms of their utilization in molecular diagnostics and related applications.

show abstract

Efficiency of PCR-RFLP and species-specific PCR for the identification of meat origin in dry sausages

Cited by 11 publications

References 26 publications

Sequential use of real-time polymerase chain reaction and enzyme-linked immunosorbent assay techniques verifies adulteration of fermented sausages with chicken meat

Sequential use of real-time polymerase chain reaction and enzyme-linked immunosorbent assay techniques verifies adulteration of fermented sausages with chicken meat

Effectual Gold Nanoprobe Sensor for Screening Cow Milk Adulteration in Goat Milk—Comparison With Conventional PCR

Exploring the Potential and Limitations of PCR-RFLP and PCR-SSCP for SNP Detection: A Review

Contact Info

Product

Resources

About