Effects of retinoic acid on growth hormone-releasing hormone receptor, growth hormone secretagogue receptor gene expression and growth hormone secretion in rat anterior pituitary cells

Maliza, Rita; Fujiwara, Ken; Tsukada, Takehiro; Azuma, Morio; Kikuchi, Motoshi; Yashiro, Takashi

doi:10.1507/endocrj.ej16-0086

Cited by 8 publications

(8 citation statements)

References 23 publications

(24 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We hypothesized that MK produced in FS cells acts locally on these hormone-producing cells via PTPRZ1 in the anterior pituitary. We also reported that RA increased Ghrh-r and Ghs-r gene expression and promoted GHRH-and ghrelin-induced GH release from isolated rat anterior pituitary cells [4]. Past and present evidence suggests that RA and MK function as autocrine and paracrine signaling molecules in the anterior pituitary gland.…”

Section: Resultssupporting

confidence: 51%

See 1 more Smart Citation

Effect of retinoic acid on midkine gene expression in rat anterior pituitary cells

et al. 2017

Self Cite

View full text Add to dashboard Cite

Section: Resultssupporting

confidence: 51%

“…Anterior pituitary cells of rats were dispersed as described previously [4]. The cells (5 × 10 5 cells) were seeded in 24-well plates and then incubated at 37°C in a humidified atmosphere of 5% CO 2 and 95% air.…”

Section: Primary Culture Of Anterior Pituitary Cellsmentioning

confidence: 99%

Effect of retinoic acid on midkine gene expression in rat anterior pituitary cells

et al. 2017

Self Cite

View full text Add to dashboard Cite

“…Rats were housed in a temperature-controlled room (22 ± 1°C) with a 12-hour light/12-hour dark cycle and illumination from 0700 h to 1900 h, and were given ad libitum access to conventional food and water. Anterior pituitary cells of rats aged 10–12 weeks were dispersed as described previously [35]. The cells were suspended in M199 medium (Life Technologies, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.…”

Section: Methodsmentioning

confidence: 99%

Role of NeuroD1 on the negative regulation of Pomc expression by glucocorticoid

et al. 2017

Self Cite

View full text Add to dashboard Cite

The mechanism of the negative regulation of proopiomelanocortin gene (Pomc) by glucocorticoids (Gcs) is still unclear in many points. Here, we demonstrated the involvement of neurogenic differentiation factor 1 (NeuroD1) in the Gc-mediated negative regulation of Pomc. Murine pituitary adrenocorticotropic hormone (ACTH) producing corticotroph tumor-derived AtT20 cells were treated with dexamethasone (DEX) (1–100 nM) and cultured for 24 hrs. Thereafter, Pomc mRNA expression was studied by quantitative real-time PCR and rat Pomc promoter (-703/+58) activity was examined by luciferase assay. Both Pomc mRNA expression and Pomc promoter activity were inhibited by DEX in a dose-dependent manner. Deletion and point mutant analyses of Pomc promoter suggested that the DEX-mediated transcriptional repression was mediated via E-box that exists at -376/-371 in the promoter. Since NeuroD1 is known to bind to and activate E-box of the Pomc promoter, we next examined the effect of DEX on NeuroD1 expression. Interestingly, DEX dose-dependently inhibited NeuroD1 mRNA expression, mouse NeuroD1 promoter (-2.2-kb) activity, and NeuroD1 protein expression in AtT20 cells. In addition, we confirmed the inhibitory effect of DEX on the interaction of NeuroD1 and E-box on Pomc promoter by chromatin immunoprecipitation (ChIP) assay. Finally, overexpression of mouse NeuroD1 could rescue the DEX-mediated inhibition of Pomc mRNA expression and Pomc promoter activity. Taken together, it is suggested that the suppression of NeuroD1 expression and the inhibition of NeuroD1/E-box interaction may play an important role in the Gc-mediated negative regulation of Pomc.

show abstract

“…Using ELISA, we measured the GH in both the supernatant and the cells. Since MtT/S cells express functional growth hormone-releasing hormone receptors (GHRHs), we used a human GRF to stimulate GH secretion from the cells into the supernatant [15,[26][27][28][29]. As shown in Fig.…”

Section: The Amount Of Gh Was Increased In Both the Cells And The Supmentioning

confidence: 99%

“…Reactions were performed in a SYBR Green Real-Time PCR Master Mix Plus (Toyobo, Osaka, Japan), including 0.5 μM gene-specific primer sets. The sequences of the primers used in this study are as follows: Rat and mouse GPR4 forward GCAAGCTCTTTGGCTTCATC, reverse GTGTGGTTGTAGCGATCACG; rat and mouse GH forward GGACCGCGTCTATGAGAAAC, reverse GCTTGAGGATCTGCCCAATA; rat PRL forward GCCAAAGAGATTGAGGAACAA, reverse ATGGGAGTTGTGACCAAACC; rat and mouse hypoxanthine phosphoribosyltransferase (HPRT1) forward CTTTGCTGACCTGCTGGATT, reverse TCCACTTTCGCTGATGACAC; and rat and mouse TATA box-binding protein (TBP) forward GATCAAACCCAGAATTGTTCTCC, reverse ATGTGGTCTTCCTGAATCCC.Quantification of the PCR products was performed using the comparative CT method (ΔCT method) to estimate the mRNA copy number relative to that of the TBP used as an internal standard.ELISAMtT/S cells were preincubated under the indicated pH of DMEM in the presence of 10 nM corticosterone for 2 days in 24-well multiplates[26,27]. After the pH medium was removed, the cells were further incubated with HEPES-Regular at pH 7.4 (500 µl/well) for 30 min.…”

mentioning

confidence: 99%

Involvement of GPR4 in increased <i>growth hormone</i> and <i>prolactin</i> expressions by extracellular acidification in MtT/S cells

et al. 2020

View full text Add to dashboard Cite

Hormone-secreting pituitary adenomas show unregulated hormonal hypersecretion and cause hyperpituitarism. However, the mechanism of the unregulated hormone production and secretion has not yet been fully elucidated. Solid tumors show reduced extracellular pH, partly due to lactate secretion from anaerobic glycolysis. It is known that extracellular acidification affects hormone secretion. However, whether and how the extracellular acidification influences the unregulated hormone production and secretion remain unknown. In the present study, we found that GPR4, a proton-sensing G protein-coupled receptor, was highly expressed in MtT/S cells, a growth hormone-producing and prolactin-producing pituitary tumor cell line. When we reduced the extracellular pH, growth hormone and prolactin mRNA expressions increased in the cells. Both increased expressions were partially suppressed by a GPR4 antagonist. We also found that extracellular acidification enhanced growth hormone-releasing factor-induced growth hormone secretion from MtT/S cells. These results suggest that GPR4 may play a role in hypersecretion of the hormone from hormone-producing pituitary tumors. A GPR4 antagonist will be a useful tool for preventing the hypersecretion.

show abstract

Effects of retinoic acid on growth hormone-releasing hormone receptor, growth hormone secretagogue receptor gene expression and growth hormone secretion in rat anterior pituitary cells

Cited by 8 publications

References 23 publications

Effect of retinoic acid on midkine gene expression in rat anterior pituitary cells

Effect of retinoic acid on midkine gene expression in rat anterior pituitary cells

Role of NeuroD1 on the negative regulation of Pomc expression by glucocorticoid

Involvement of GPR4 in increased <i>growth hormone</i> and <i>prolactin</i> expressions by extracellular acidification in MtT/S cells

Contact Info

Product

Resources

About