Effects of Phenyllactic Acid, Lactic Acid Bacteria, and Their Mixture on Fermentation Characteristics and Microbial Community Composition of Timothy Silage

Abstract

This study investigated the effects of phenyllactic acid (PL), lactic acid bacteria (LAB), and their mixture on fermentation characteristics and microbial community composition of timothy silage. Timothy silages were treated without (CK) or with PL [10 mg/kg fresh matter (FM) basis], LAB inoculant (IN; a mixture of Lactobacillus plantarum and L.buchneri, 105 cfu/g FM), and their mixture (PI) and stored at ambient temperature (5°C∼15°C) in a dark room for 60 days. Compared with CK, all treated silages showed lower (P < 0.05) levels of butyric acid and ammonia-N. Treatment with PL enhanced (P < 0.05) the crude protein preservation of silage by favoring the growth of L. curvatus and Saccharomyces cerevisiae and inhibition of lactic acid–assimilating yeast belonging to Issatchenkia during ensiling. In particular, treatment with PL advanced (P < 0.05) the productions of lactic acid and volatile fatty acid in IN-treated silage. Therefore, PL used as a new additive exhibited potential for improving silage fermentation when it is combined with LAB IN during ensiling.

Effects of epiphytic and exogenous lactic acid bacteria on fermentation quality and microbial community compositions of paper mulberry silage

“…Microbial DNA was extracted from the fresh PM and silage according to the method described in Li et al (2021) . In brief, a Power Soil DNA Isolation Kit (MO BIO Laboratories) was used to extract microbial DNA following the manufacturer’s instructions.…”

“…The primers 341F (5′-CCTAYGGGRBGCASCAG-3′) and 806R (5′-GGACTACNNGGGTATCTAAT-3′) were chosen to amplify the V3-V4 region of the 16S rRNA gene. The primers ITS1F (5′– CTTGGTCATTTAGAGGAAGTAA–3′) and ITS2-2043R (5′-GCTGCGTTCTTCATCGATGC-3′) were used to amplify the ITS gene ( Li et al, 2021 ). Novogene (Beijing, China) completed library construction and Illumina S5 sequencing according to the manufacturer’s instructions.…”

“…Previously published studies indicated that a high abundance of harmful bacteria (such as Enterobacter or Clostridium ) and a low abundance of beneficial bacteria (such as Lactobacillus ) in silage were the main challenges for proper PM ensiling ( Cheng et al, 2021a ; Du et al, 2021 ). However, the structure and abundance of fungal community members (such as Saccharomyces , Cladosporium or Issatchenkia ) during the ensiling process also affected the fermentation quality of silage ( Li et al, 2021 ). Therefore, the composition and shift in bacteria and fungi may affect the fermentation quality of PM silage.…”

“…Therefore, the composition and shift in bacteria and fungi may affect the fermentation quality of PM silage. In recent years, 16S rRNA and ITS sequencing has changed our understanding of bacterial and fungal communities in fresh and ensiled forages, including alfalfa ( Bai et al, 2020 ), sugarcane ( Wang et al, 2020 ), and timothy ( Li et al, 2021 ). To the best of our knowledge, there have been no reports on the diversity of the fungal community in fresh and ensiled PM.…”

Freeze–thaw condition limits the fermentation process and accelerates the aerobic deterioration of oat (Avena sativa) silage in the Qinghai-Tibet Plateau

“…This suggests that the silage from the two treatments may have entered the stable stage on day 14, at which point the fermentation may have been completed. Li et al (2021a) have claimed that due to the increase of LAB, the pH decreases continuously, for this reason, the growth of other microorganisms is inhibited, causing the diversity and richness of bacterial community to quickly reduce. However, as the fermentation was prolonged, the inhibition declined, causing spoilage microorganisms to emerge.…”