Effects of meal composition and meal timing on the expression of genes involved in hepatic drug metabolism in rats

Abstract

IntroductionWith chronotherapy, drug administration is synchronized with daily rhythms in drug clearance and pharmacokinetics. Daily rhythms in gene expression are centrally mastered by the suprachiasmatic nucleus of the hypothalamus as well as by tissue clocks containing similar molecular mechanisms in peripheral organs. The central timing system is sensitive to changes in the external environment such as those of the light-dark cycle, meal timing and meal composition. We investigated how changes in diet composition and meal timing would affect the daily hepatic expression rhythms of the nuclear receptors PXR and CAR and of enzymes involved in P450 mediated drug metabolism, as such changes could have consequences for the practice of chronotherapy.Materials and methodsRats were subjected to either a regular chow or a free choice high-fat-high-sugar (fcHFHS) diet. These diets were provided ad libitum, or restricted to either the light phase or the dark phase. In a second experiment, rats had access to chow either ad libitum or in 6 meals equally distributed over 24 hours.ResultsPxr, Alas1 and Por displayed significant day-night rhythms under ad libitum chow fed conditions, which for Pxr was disrupted under fcHFHS diet conditions. Although no daily rhythms were detected in expression of CAR, Cyp2b2 and Cyp3a2, the fcHFHS diet did affect basal expression of these genes. In chow fed rats, dark phase feeding induced a diurnal rhythm in Cyp2b2 expression while light phase feeding induced a diurnal rhythm in Car expression and completely shifted the peak expression of Pxr, Car, Cyp2b2, Alas1 and Por. The 6-meals-a-day feeding only abolished the Pxr rhythm but not the rhythms of the other genes.ConclusionWe conclude that although nuclear receptors and enzymes involved in the regulation of hepatic drug metabolism are sensitive to meal composition, changes in meal timing are mainly effectuated via changes in the molecular clock.

Regulation of CAR and PXR Expression in Health and Disease

“…In rats, Pxr displays significant daily oscillations. On the other hand, Car mRNA expression tends to be higher in the dark than in the light period [70], whereas it clearly exhibits diurnal difference according to another study [71]. Moreover, the circadian variation of Car, Pxr, and the related Cyp genes is sexually dimorphic, with higher expression reported in female over male mouse liver [21].…”

A Free-Choice High-Fat High-Sugar Diet Alters Day–Night Per2 Gene Expression in Reward-Related Brain Areas in Rats

“…Tissue was placed in TRIzol (QIAGEN) and homogenized using an ULTRA THURRAX homogenizer (IKA, Germany). RNA extraction and RT-PCR was performed for Per2, Bmal1, Vglut2, Orexin ( 11 ), Cry1 (F primer: AAGTCATCGTGCGCATTTCA; R primer TCATCATGGTCGTCGGACAGA), and pre-pro-enkephalin (F primer: CTTGTCAGAGACAGAACGGGT; R primer CCTTGCAGGTCTCCCAGATTT) as described previously ( 12 ).Reference genes: Cyclophilin (F primer ATGTGGTCTTTGGGAAGGTG; R primer GAAGGAATGGTTTGATGGGT), β-Actin (F primer ACAACCTTCTTGCAGCTCCTC; R primer CTGACCCATACCCACCATCAC).…”

Metabolic Effects of Light at Night are Time‐ and Wavelength‐Dependent in Rats

“…Liver tissues were homogenized with tri-reagent using an Ultra-Turrax device (IKA, Staufen, Germany) in order to prevent RNA degradation. RNA isolation and complementary DNA synthesis were performed as described elsewhere (17,18) and in the Supporting Information.…”