Effects of maternal diet-induced obesity on metabolic disorders and age-associated miRNA expression in the liver of male mouse offspring

Abstract

Objective This study investigated the effect of maternal obesity on aged-male offspring liver phenotype and hepatic expression of a programmed miRNA. Methods A mouse model (C57BL/6 J) of maternal diet-induced obesity was used to investigate fasting-serum metabolites, hepatic lipid content, steatosis, and relative mRNA levels (RT-PCR) and protein expression (Western blotting) of key components involved in hepatic and mitochondrial metabolism in 12-month-old offspring. We also measured hepatic lipid peroxidation, mitochondrial content, fibrosis stage, and apoptosis in the offspring. To investigate potential mechanisms leading to the observed phenotype, we also measured the expression of miR-582 (a miRNA previously implicated in liver cirrhosis) in 8-week-old and 12-month-old offspring. Results Body weight and composition was similar between 8-week-old offspring, however, 12-month-old offspring from obese mothers had increased body weight and fat mass (19.5 ± 0.8 g versus 10.4 ± 0.9 g, p < 0.001), as well as elevated serum levels of LDL and leptin and hepatic lipid content (21.4 ± 2.1 g versus 12.9 ± 1.8 g, p < 0.01). This was accompanied by steatosis, increased Bax/Bcl-2 ratio, and overexpression of p-SAPK/JNK, Tgfβ1, Map3k14, and Col1a1 in the liver. Decreased levels of Bcl-2, p-AMPKα, total AMPKα and mitochondrial complexes were also observed. Maternal obesity was associated with increased hepatic miR-582-3p (p < 0.001) and miR-582-5p (p < 0.05). Age was also associated with an increase in both miR-582-3p and miR-582-5p, however, this was more pronounced in the offspring of obese dams, such that differences were greater in 12-month-old animals (−3p: 7.34 ± 1.35 versus 1.39 ± 0.50, p < 0.0001 and −5p: 4.66 ± 1.16 versus 1.63 ± 0.65, p < 0.05). Conclusion Our findings demonstrate that maternal diet-induced obesity has detrimental effects on offspring body composition as well as hepatic phenotype that may be indicative of accelerated-ageing phenotype. These whole-body and cellular phenotypes were associated with age-dependent changes in expression of miRNA-582 that might contribute mechanistically to the development of metabolic disorders in the older progeny.

Maternal obesity and programming of metabolic syndrome in the offspring: searching for mechanisms in the adipocyte progenitor pool

“…Decades of research into the developmental origins of health and disease (DOHaD) firmly establish that early windows of organ development shape later life chronic disease risk. It is well recognized that maternal obesity or diabetes during pregnancy increases the risk for obesity and MetS in the offspring [ 13 , 15 , 16 , 29 , 96 , 97 ]. The most common perinatal outcome associated with pregnancies complicated by obesity or diabetes is fetal macrosomia primarily due to elevated adiposity.…”

Sex-specific effects of maternal metformin intervention during glucose-intolerant obese pregnancy on body composition and metabolic health in aged mouse offspring

“…Serum cholesterol and triglycerides were measured by the Core Biochemical Assay Laboratory (University of Cambridge). Ppia GTCCAGGAATGGCAAGACCA GGGTAAATGCCCGCAAGTC Mennitti et al [23] Tnf AAGTTCCCAAATGGCCTCCC CACTTGGTGGTTTGCTACGA Alfaradhi et al [22] Primer pair for Ccl2 was generated for this paper using Primer-BLAST software [24] Statistical analysis Data are presented as mean ± SEM and analysed using Prism v.9.0 software (GraphPad, USA) using one-way ANOVA, two-way ANOVA or non-parametric alternatives where appropriate. Correlation was assessed using two-tailed Spearman correlation in Prism v9.0.…”

“…Data are presented as expression relative to the relevant control group. Primer sequences are shown in Table 1 , either obtained from the literature ( Itgax [also known as Cd11c ], Adgre1 [also known as F4/80 ], Tnf [ 22 ] and Ppia [ 23 ]) or designed using Primer-BLAST software [ 24 ] ( Ccl2 ; also known as Mcp1 ).…”

Dilemma of Epigenetic Changes Causing or Reducing Metabolic Disorders in Offsprings of Obese Mothers

“…A study showed that miR-506-3p increases glucose uptake and regulate genes including PI3K, AKT, IRS1, and GLUT4, which are the key component of the PI3K/AKT insulin signalling pathway and thus play role in modulating insulin resistance [92]. It was found that 12-month-old offspring of obese dams had increased body weight and fat mass and exhibited an elevated level of hepatic miR-582-3p and miR-582-5p [93]. Zhou et al characterised the exosomes from the adipose tissue of an obese sow and found they regulate endothelial cell migration and angiogenesis through miR-221 implicated in placental dysplasia during gestation [94].…”