Effects of Long Term Antibiotic Therapy on Human Oral and Fecal Viromes

Abstract

Viruses are integral members of the human microbiome. Many of the viruses comprising the human virome have been identified as bacteriophage, and little is known about how they respond to perturbations within the human ecosystem. The intimate association of phage with their cellular hosts suggests their communities may change in response to shifts in bacterial community membership. Alterations to human bacterial biota can result in human disease including a reduction in the host's resilience to pathogens. Here we report the ecology of oral and fecal viral communities and their responses to long-term antibiotic therapy in a cohort of human subjects. We found significant differences between the viral communities of each body site with a more heterogeneous fecal virus community compared with viruses in saliva. We measured the relative diversity of viruses, and found that the oral viromes were significantly more diverse than fecal viromes. There were characteristic changes in the membership of oral and fecal bacterial communities in response to antibiotics, but changes in fecal viral communities were less distinguishing. In the oral cavity, an abundance of papillomaviruses found in subjects on antibiotics suggests an association between antibiotics and papillomavirus production. Despite the abundance of papillomaviruses identified, in neither the oral nor the fecal viromes did antibiotic therapy have any significant impact upon overall viral diversity. There was, however, an apparent expansion of the reservoir of genes putatively involved in resistance to numerous classes of antibiotics in fecal viromes that was not paralleled in oral viromes. The emergence of antibiotic resistance in fecal viromes in response to long-term antibiotic therapy in humans suggests that viruses play an important role in the resilience of human microbial communities to antibiotic disturbances.

Transmission of viruses via our microbiomes

“…These results are similar to a prior study in which we noted that human oral viruses were highly persistent over time [12]. The use of relatively narrow spectrum oral antibiotics such as amoxicillin and azithromycin may have contributed to the stability observed in virome contents, as we observed much greater turnover in virome contents when broad spectrum intravenous antibiotics were used in a separate cohort [10]. We believe that there is a relatively stable core of viruses that inhabit an individual’s microbiome, and that there are other viruses more susceptible to being replaced as individuals are exposed to perturbations such as viruses transmitted from their close contacts.…”

“…Only the fraction with a density corresponding to most known bacteriophages [21] was retained, further purified on Amicon YM-100 protein purification columns (Millipore, Inc.), treated with two units of DNase I, and subjected to lysis and DNA purification using the Qiagen UltraSens Virus kit (Qiagen). Recovered DNA was screened for the presence of contaminating bacterial nucleic acids by quantitative 16S rRNA gene PCR using primers 8 F (AGAGTTTGATCCTGGCTCAG) and 357R (CTGCTGCCTYCCGTA) in Power SYBR Green PCR Mastermix (Thermo Fisher Scientific) [10]. No products were detected in any of the viromes after 35 cycles, which does not exclude the presence of contaminating bacterial nucleic acids, but indicates that they were not present at dominant levels.…”

“…Viral communities also respond to perturbations, although in different ways than might be predicted based on the responses of their bacterial hosts. The gut viromes of mice and humans have more homologues to genes involved in antibiotic resistance after antibiotic perturbations [9, 10], but a recent study indicates that most of these genes might not be involved in antibiotic resistance [11]. Viral communities do not appear to have altered diversity in the long-term in response to antimicrobial therapy, potentially because viruses that exit the community after perturbations are replaced by other eukaryotic viruses [10].…”

Translational metagenomics and the human resistome: confronting the menace of the new millennium

“…A broad range of ARGs was detected at different time points in human intestinal viral metagenome sequences from six and five individuals, respectively. ARGs included multidrug efflux transporters, tetracycline and vancomycin resistance genes, and ß-lactamases [59, 60]. …”

“…ARGs mediating resistance to ß-lactams, vancomycin, aminoglycosides, macrolides, tetracyclines and chloramphenicol were detected in viral metagenome sequences from the saliva of five individuals sampled at different time points [60]. Another analysis of five metagenomic virome datasets of sputum samples from cystic fibrosis patients found evidence for an increased abundance of various ARGs when compared to datasets of individuals without disease [61].…”