Effects of genetically modified T2A-1 rice on the GI health of rats after 90-day supplement

Abstract

Bacillus thuringiensis insecticidal toxin (Bt) rice will be commercialized as a main food source. Traditional safety assessments on genetically modified products pay little attention on gastrointestinal (GI) health. More data about GI health of Bt rice must be provided to dispel public' doubts about the potential effects on human health. We constructed an improved safety assessment animal model using a basic subchronic toxicity experiment, measuring a range of parameters including microflora composition, intestinal permeability, epithelial structure, fecal enzymes, bacterial activity, and intestinal immunity. Significant differences were found between rice-fed groups and AIN93G-fed control groups in several parameters, whereas no differences were observed between genetically modified and non-genetically modified groups. No adverse effects were found on GI health resulting from genetically modified T2A-1 rice. In conclusion, this study may offer a systematic safety assessment model for GM material with respect to the effects on GI health.

Long-term toxicity study on genetically modified corn with cry1Ac gene in a Wuzhishan miniature pig model

“…The serum concentrations of TG and TCHO were not affected by the diet treatment. Yuan et al also reported serum concentrations of triglyceride and total cholesterol were similar between Bt and isogenic rice diets fed to the rats for a 90‐day study.…”

Safety assessment of GM plants: An updated review of the scientific literature

“…In turn, Zhang et al (2014) and Song et al (2015), obtained also similar conclusions in a long-term toxicity study on transgenic rice, with Cry1Ac and sck genes, and in a 90-day subchronic feeding study of GM rice expressing Cry1Ab protein, respectively, both conducted in SD rats. Yuan et al (2013) determined in SD rats feed with GM T2A1 rice, parameters such as microflora composition, intestinal permeability, epithelial structure, fecal enzymes, bacterial activity, and intestinal immunity. Although significant differences were noted between rice-fed groups and control groups in some parameters, no differences were detected between GM and non-GM groups.…”

In Vivo Effects of Pichia Pastoris-Expressed Antimicrobial Peptide Hepcidin on the Community Composition and Metabolism Gut Microbiota of Rats

“…338F: ACTCCTACGGGAGGCAGCAG and 518R: ATTACCGCGGCTGCTGG were used as primers. Genomic DNA of Escherichia coli with a detection range from 10 3 to 10 12 DNA copies/μl was used to create a standard curve [ 22 ].…”